Incidental Mutation 'R7685:Mllt6'
ID 593023
Institutional Source Beutler Lab
Gene Symbol Mllt6
Ensembl Gene ENSMUSG00000038437
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms Af17
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7685 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 97663414-97685463 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97676964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 739 (L739P)
Ref Sequence ENSEMBL: ENSMUSP00000045445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]
AlphaFold B1AR10
Predicted Effect probably damaging
Transcript: ENSMUST00000044730
AA Change: L739P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437
AA Change: L739P

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107586
AA Change: L769P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437
AA Change: L769P

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik C A 2: 92,383,472 P68Q probably damaging Het
Abcg3 A G 5: 104,968,215 L251S probably damaging Het
Acsbg1 C T 9: 54,628,559 S53N unknown Het
Adamts18 A G 8: 113,713,223 C913R probably damaging Het
Adck5 C A 15: 76,595,388 Y524* probably null Het
Adgrv1 G T 13: 81,103,324 Q6225K possibly damaging Het
Ahr T C 12: 35,504,017 N701S probably damaging Het
Apc T C 18: 34,314,208 C1386R probably damaging Het
Bbs1 A G 19: 4,906,154 S38P probably benign Het
Celsr1 G T 15: 85,978,732 C1366* probably null Het
Cep290 A C 10: 100,540,057 H1424P probably benign Het
Clcn3 C T 8: 60,933,085 R311K possibly damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dhx9 A G 1: 153,458,406 Y1002H probably damaging Het
Dnah8 C T 17: 30,657,973 T533I probably damaging Het
Ermard T C 17: 15,059,462 S505P probably benign Het
Fbxw17 G A 13: 50,425,644 D166N probably damaging Het
Fmo3 T C 1: 162,958,332 K363R possibly damaging Het
Gadd45gip1 A T 8: 84,832,351 R21W probably damaging Het
Galnt4 A G 10: 99,109,964 N517S probably benign Het
Ganc T A 2: 120,433,792 W409R probably damaging Het
Glrx3 T C 7: 137,459,191 S185P probably damaging Het
Gm49368 T C 7: 128,113,242 S853P probably damaging Het
Gtf3c2 A C 5: 31,168,267 L443V probably damaging Het
Gxylt2 A T 6: 100,804,528 Q388L probably benign Het
Hcar2 C T 5: 123,865,333 V36M possibly damaging Het
Ifit3b A T 19: 34,612,555 D377V possibly damaging Het
Ints5 A G 19: 8,896,804 D709G probably benign Het
Lyst A G 13: 13,669,865 E1880G probably benign Het
Mep1a C T 17: 43,479,174 S428N probably benign Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Mmel1 T C 4: 154,871,654 M1T probably null Het
Muc5ac C T 7: 141,809,383 P2144S unknown Het
Myh4 T C 11: 67,240,930 V72A probably benign Het
Naa15 T A 3: 51,469,974 probably null Het
Nlrc5 A G 8: 94,521,400 probably null Het
Nme8 T A 13: 19,650,975 M514L probably benign Het
Nudt9 C A 5: 104,047,080 S14* probably null Het
Olfr538 T C 7: 140,574,246 F31S probably damaging Het
Olfr748 A T 14: 50,710,758 I143F possibly damaging Het
Optn G A 2: 5,054,650 T19I probably benign Het
Osbpl8 T A 10: 111,276,509 L495* probably null Het
Panx2 T C 15: 89,067,770 S147P possibly damaging Het
Pclo T A 5: 14,680,616 V3044D unknown Het
Pcnt T C 10: 76,422,808 K608E probably benign Het
Pde7a T A 3: 19,227,745 N447I probably damaging Het
Peli2 G T 14: 48,280,034 C186F not run Het
Pgm5 A G 19: 24,727,851 F433L probably benign Het
Plce1 G A 19: 38,748,433 V1588I probably benign Het
Plin4 T A 17: 56,102,413 H1295L probably benign Het
Poli T C 18: 70,525,519 E134G probably benign Het
Pramef6 T A 4: 143,897,801 D42V probably benign Het
Ptprq T A 10: 107,643,978 I1144F probably damaging Het
Ptprz1 A T 6: 23,024,978 T1738S probably damaging Het
Pxdc1 A G 13: 34,652,284 L51P probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhd T A 4: 134,884,509 probably null Het
Rpp14 T C 14: 8,090,453 S126P probably damaging Het
Scn7a C T 2: 66,676,192 C1451Y probably damaging Het
Sdr39u1 G A 14: 55,897,734 R251* probably null Het
Sephs2 G T 7: 127,273,334 P196T possibly damaging Het
Slc22a16 T C 10: 40,574,089 Y195H possibly damaging Het
Spg11 C A 2: 122,068,880 V1575F probably damaging Het
Sqle C T 15: 59,316,041 S66L probably benign Het
Tas2r124 T G 6: 132,755,093 W122G probably damaging Het
Tex52 A T 6: 128,384,958 probably null Het
Thoc1 T A 18: 9,993,454 C604* probably null Het
Tmc3 T C 7: 83,597,458 S136P probably damaging Het
Tmem212 T A 3: 27,896,313 T11S probably benign Het
Ubn2 A G 6: 38,491,792 N1147S probably benign Het
Uggt2 A G 14: 119,075,347 I350T probably damaging Het
Ust A T 10: 8,207,575 Y346N probably damaging Het
Vwa8 A G 14: 79,098,300 T1399A probably benign Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp800 C A 6: 28,244,194 K257N probably damaging Het
Zfp985 T A 4: 147,582,874 D66E probably benign Het
Other mutations in Mllt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Mllt6 APN 11 97676928 missense probably damaging 1.00
IGL01808:Mllt6 APN 11 97672484 missense possibly damaging 0.88
IGL01967:Mllt6 APN 11 97674777 missense probably damaging 0.98
IGL02247:Mllt6 APN 11 97670332 missense probably benign 0.01
IGL03161:Mllt6 APN 11 97667151 missense probably benign 0.03
R0284:Mllt6 UTSW 11 97678605 missense probably benign 0.02
R0718:Mllt6 UTSW 11 97676359 splice site probably benign
R0783:Mllt6 UTSW 11 97665745 missense probably damaging 0.99
R0811:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0812:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0904:Mllt6 UTSW 11 97664998 missense probably damaging 1.00
R0960:Mllt6 UTSW 11 97664946 splice site probably benign
R1445:Mllt6 UTSW 11 97672451 splice site probably benign
R1523:Mllt6 UTSW 11 97665023 missense probably damaging 1.00
R1781:Mllt6 UTSW 11 97672569 missense probably benign
R1952:Mllt6 UTSW 11 97677222 missense probably damaging 0.99
R2258:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2259:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2927:Mllt6 UTSW 11 97680776 missense probably damaging 0.98
R4866:Mllt6 UTSW 11 97674459 missense probably damaging 1.00
R4938:Mllt6 UTSW 11 97678407 missense probably benign
R5039:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5058:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5064:Mllt6 UTSW 11 97673949 missense probably damaging 1.00
R5076:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5115:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5379:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5509:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5510:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5511:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5603:Mllt6 UTSW 11 97673505 missense probably damaging 1.00
R5816:Mllt6 UTSW 11 97672574 missense probably damaging 0.97
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6051:Mllt6 UTSW 11 97680743 nonsense probably null
R6180:Mllt6 UTSW 11 97678536 missense possibly damaging 0.85
R6277:Mllt6 UTSW 11 97673948 missense probably damaging 1.00
R6667:Mllt6 UTSW 11 97676934 missense probably damaging 1.00
R6754:Mllt6 UTSW 11 97674447 missense probably damaging 1.00
R6791:Mllt6 UTSW 11 97680602 missense probably damaging 0.98
R7049:Mllt6 UTSW 11 97673811 missense probably damaging 1.00
R7194:Mllt6 UTSW 11 97673568 missense probably benign 0.23
R7387:Mllt6 UTSW 11 97674600 missense probably benign 0.04
R7484:Mllt6 UTSW 11 97672616 missense probably benign 0.18
R7853:Mllt6 UTSW 11 97670316 missense probably benign
R7862:Mllt6 UTSW 11 97665805 missense probably benign 0.03
R8004:Mllt6 UTSW 11 97676140 missense possibly damaging 0.91
R8498:Mllt6 UTSW 11 97676862 missense possibly damaging 0.86
R9044:Mllt6 UTSW 11 97663659 missense probably damaging 1.00
R9297:Mllt6 UTSW 11 97672488 missense probably damaging 0.96
R9457:Mllt6 UTSW 11 97665760 missense probably benign 0.12
R9557:Mllt6 UTSW 11 97673484 missense probably benign 0.04
Z1177:Mllt6 UTSW 11 97676425 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATCTGGAGCAGCCTCTAAGG -3'
(R):5'- GCTGCTGGTTAGTCACTAGACC -3'

Sequencing Primer
(F):5'- TGGAGCAGCCTCTAAGGATATCTC -3'
(R):5'- CTGCTGGTTAGTCACTAGACCAAAGG -3'
Posted On 2019-11-12