Mutagenetix > Incidental Mutations

Ensembl: ENSMUST00000019400

Incidental Mutation 'R7685:Ahr'

593024

Institutional Source

Beutler Lab

Gene Symbol

Ahr

Ensembl Gene

ENSMUSG00000019256

Gene Name

aryl-hydrocarbon receptor

Synonyms

bHLHe76, In, dioxin receptor, Ah, Ahh, Ahre

MMRRC Submission

Accession Numbers

Genbank: NM_013464; MGI: 105043;

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R7685 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35497974-35535038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35504017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 701 (N701S)

Ref Sequence

ENSEMBL: ENSMUSP00000112137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000110811

SMART Domains

Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256

Domain	Start	End	E-Value	Type
HLH	33	87	3.31e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000116436
AA Change: N701S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: N701S

Domain	Start	End	E-Value	Type
HLH	33	87	5.09e-7	SMART
PAS	111	177	2.72e-12	SMART
low complexity region	212	222	N/A	INTRINSIC
PAS	266	336	1.77e-2	SMART
PAC	342	383	2.39e-8	SMART
low complexity region	606	640	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	C	A	2: 92,383,472	P68Q	probably damaging	Het
Abcg3	A	G	5: 104,968,215	L251S	probably damaging	Het
Acsbg1	C	T	9: 54,628,559	S53N	unknown	Het
Adamts18	A	G	8: 113,713,223	C913R	probably damaging	Het
Adck5	C	A	15: 76,595,388	Y524*	probably null	Het
Adgrv1	G	T	13: 81,103,324	Q6225K	possibly damaging	Het
Apc	T	C	18: 34,314,208	C1386R	probably damaging	Het
Bbs1	A	G	19: 4,906,154	S38P	probably benign	Het
Celsr1	G	T	15: 85,978,732	C1366*	probably null	Het
Cep290	A	C	10: 100,540,057	H1424P	probably benign	Het
Clcn3	C	T	8: 60,933,085	R311K	possibly damaging	Het
Crat	C	T	2: 30,404,565	R497Q	probably benign	Het
Dhx9	A	G	1: 153,458,406	Y1002H	probably damaging	Het
Dnah8	C	T	17: 30,657,973	T533I	probably damaging	Het
Ermard	T	C	17: 15,059,462	S505P	probably benign	Het
Fbxw17	G	A	13: 50,425,644	D166N	probably damaging	Het
Fmo3	T	C	1: 162,958,332	K363R	possibly damaging	Het
Gadd45gip1	A	T	8: 84,832,351	R21W	probably damaging	Het
Galnt4	A	G	10: 99,109,964	N517S	probably benign	Het
Ganc	T	A	2: 120,433,792	W409R	probably damaging	Het
Glrx3	T	C	7: 137,459,191	S185P	probably damaging	Het
Gm49368	T	C	7: 128,113,242	S853P	probably damaging	Het
Gtf3c2	A	C	5: 31,168,267	L443V	probably damaging	Het
Gxylt2	A	T	6: 100,804,528	Q388L	probably benign	Het
Hcar2	C	T	5: 123,865,333	V36M	possibly damaging	Het
Ifit3b	A	T	19: 34,612,555	D377V	possibly damaging	Het
Ints5	A	G	19: 8,896,804	D709G	probably benign	Het
Lyst	A	G	13: 13,669,865	E1880G	probably benign	Het
Mep1a	C	T	17: 43,479,174	S428N	probably benign	Het
Mllt6	T	C	11: 97,676,964	L739P	probably damaging	Het
Mlst8	T	C	17: 24,476,057	Y284C	probably damaging	Het
Mmel1	T	C	4: 154,871,654	M1T	probably null	Het
Muc5ac	C	T	7: 141,809,383	P2144S	unknown	Het
Myh4	T	C	11: 67,240,930	V72A	probably benign	Het
Naa15	T	A	3: 51,469,974		probably null	Het
Nlrc5	A	G	8: 94,521,400		probably null	Het
Nme8	T	A	13: 19,650,975	M514L	probably benign	Het
Nudt9	C	A	5: 104,047,080	S14*	probably null	Het
Olfr538	T	C	7: 140,574,246	F31S	probably damaging	Het
Olfr748	A	T	14: 50,710,758	I143F	possibly damaging	Het
Optn	G	A	2: 5,054,650	T19I	probably benign	Het
Osbpl8	T	A	10: 111,276,509	L495*	probably null	Het
Panx2	T	C	15: 89,067,770	S147P	possibly damaging	Het
Pclo	T	A	5: 14,680,616	V3044D	unknown	Het
Pcnt	T	C	10: 76,422,808	K608E	probably benign	Het
Pde7a	T	A	3: 19,227,745	N447I	probably damaging	Het
Peli2	G	T	14: 48,280,034	C186F	not run	Het
Pgm5	A	G	19: 24,727,851	F433L	probably benign	Het
Plce1	G	A	19: 38,748,433	V1588I	probably benign	Het
Plin4	T	A	17: 56,102,413	H1295L	probably benign	Het
Poli	T	C	18: 70,525,519	E134G	probably benign	Het
Pramef6	T	A	4: 143,897,801	D42V	probably benign	Het
Ptprq	T	A	10: 107,643,978	I1144F	probably damaging	Het
Ptprz1	A	T	6: 23,024,978	T1738S	probably damaging	Het
Pxdc1	A	G	13: 34,652,284	L51P	probably damaging	Het
Rabepk	C	T	2: 34,779,296	G362S	probably damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rhd	T	A	4: 134,884,509		probably null	Het
Rpp14	T	C	14: 8,090,453	S126P	probably damaging	Het
Scn7a	C	T	2: 66,676,192	C1451Y	probably damaging	Het
Sdr39u1	G	A	14: 55,897,734	R251*	probably null	Het
Sephs2	G	T	7: 127,273,334	P196T	possibly damaging	Het
Slc22a16	T	C	10: 40,574,089	Y195H	possibly damaging	Het
Spg11	C	A	2: 122,068,880	V1575F	probably damaging	Het
Sqle	C	T	15: 59,316,041	S66L	probably benign	Het
Tas2r124	T	G	6: 132,755,093	W122G	probably damaging	Het
Tex52	A	T	6: 128,384,958		probably null	Het
Thoc1	T	A	18: 9,993,454	C604*	probably null	Het
Tmc3	T	C	7: 83,597,458	S136P	probably damaging	Het
Tmem212	T	A	3: 27,896,313	T11S	probably benign	Het
Ubn2	A	G	6: 38,491,792	N1147S	probably benign	Het
Uggt2	A	G	14: 119,075,347	I350T	probably damaging	Het
Ust	A	T	10: 8,207,575	Y346N	probably damaging	Het
Vwa8	A	G	14: 79,098,300	T1399A	probably benign	Het
Zc3h18	G	A	8: 122,413,876	R850Q	unknown	Het
Zfp800	C	A	6: 28,244,194	K257N	probably damaging	Het
Zfp985	T	A	4: 147,582,874	D66E	probably benign	Het

Other mutations in Ahr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Ahr	APN	12	35504097	nonsense	probably null
IGL01336:Ahr	APN	12	35503840	missense	probably benign	0.19
IGL01972:Ahr	APN	12	35504449	missense	possibly damaging	0.89
IGL02117:Ahr	APN	12	35512923	nonsense	probably null
IGL03028:Ahr	APN	12	35504710	missense	probably benign
IGL03110:Ahr	APN	12	35504971	missense	probably damaging	0.98
IGL03394:Ahr	APN	12	35503752	nonsense	probably null
IGL03403:Ahr	APN	12	35504326	missense	possibly damaging	0.63
BB002:Ahr	UTSW	12	35515068	nonsense	probably null
BB012:Ahr	UTSW	12	35515068	nonsense	probably null
R0620:Ahr	UTSW	12	35508194	missense	probably benign	0.26
R0784:Ahr	UTSW	12	35508142	missense	possibly damaging	0.79
R1133:Ahr	UTSW	12	35526806	missense	probably damaging	1.00
R1168:Ahr	UTSW	12	35504532	missense	possibly damaging	0.49
R4678:Ahr	UTSW	12	35507464	missense	probably damaging	1.00
R5615:Ahr	UTSW	12	35503885	missense	probably benign	0.01
R6066:Ahr	UTSW	12	35504921	missense	probably damaging	0.99
R6466:Ahr	UTSW	12	35504032	missense	probably benign	0.29
R7369:Ahr	UTSW	12	35504660	missense	possibly damaging	0.94
R7382:Ahr	UTSW	12	35504515	missense	probably damaging	1.00
R7819:Ahr	UTSW	12	35510000	missense	probably damaging	1.00
R7897:Ahr	UTSW	12	35504170	missense	possibly damaging	0.47
R7925:Ahr	UTSW	12	35515068	nonsense	probably null
R8179:Ahr	UTSW	12	35510051	missense	probably benign	0.01
R8274:Ahr	UTSW	12	35510069	missense	probably benign
R8342:Ahr	UTSW	12	35508272	missense	probably damaging	1.00
R8985:Ahr	UTSW	12	35526737	missense	possibly damaging	0.91
R9114:Ahr	UTSW	12	35511165	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACATGGACATGGCCCCAG -3'
(R):5'- AGCAAGATCTGGGTCCGAAG -3'

Sequencing Primer
(F):5'- CATAGTATGCCTGAGGACTGACC -3'
(R):5'- AGATCTGGGTCCGAAGCACAC -3'

Posted On

2019-11-12