Incidental Mutation 'R7685:Rpp14'
ID593030
Institutional Source Beutler Lab
Gene Symbol Rpp14
Ensembl Gene ENSMUSG00000023156
Gene Nameribonuclease P 14 subunit
Synonyms2610511E03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R7685 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location8080367-8091834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8090453 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000136494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023924] [ENSMUST00000180369]
Predicted Effect probably benign
Transcript: ENSMUST00000023924
SMART Domains Protein: ENSMUSP00000023924
Gene: ENSMUSG00000023156

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 8 109 1.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180369
AA Change: S126P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136494
Gene: ENSMUSG00000023156
AA Change: S126P

DomainStartEndE-ValueType
Pfam:MaoC_dehydratas 22 142 2e-21 PFAM
Pfam:MaoC_dehydrat_N 26 148 6.4e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik C A 2: 92,383,472 P68Q probably damaging Het
Abcg3 A G 5: 104,968,215 L251S probably damaging Het
Acsbg1 C T 9: 54,628,559 S53N unknown Het
Adamts18 A G 8: 113,713,223 C913R probably damaging Het
Adck5 C A 15: 76,595,388 Y524* probably null Het
Adgrv1 G T 13: 81,103,324 Q6225K possibly damaging Het
Ahr T C 12: 35,504,017 N701S probably damaging Het
Apc T C 18: 34,314,208 C1386R probably damaging Het
Bbs1 A G 19: 4,906,154 S38P probably benign Het
Celsr1 G T 15: 85,978,732 C1366* probably null Het
Cep290 A C 10: 100,540,057 H1424P probably benign Het
Clcn3 C T 8: 60,933,085 R311K possibly damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dhx9 A G 1: 153,458,406 Y1002H probably damaging Het
Dnah8 C T 17: 30,657,973 T533I probably damaging Het
Ermard T C 17: 15,059,462 S505P probably benign Het
Fbxw17 G A 13: 50,425,644 D166N probably damaging Het
Fmo3 T C 1: 162,958,332 K363R possibly damaging Het
Gadd45gip1 A T 8: 84,832,351 R21W probably damaging Het
Galnt4 A G 10: 99,109,964 N517S probably benign Het
Ganc T A 2: 120,433,792 W409R probably damaging Het
Glrx3 T C 7: 137,459,191 S185P probably damaging Het
Gm49368 T C 7: 128,113,242 S853P probably damaging Het
Gtf3c2 A C 5: 31,168,267 L443V probably damaging Het
Gxylt2 A T 6: 100,804,528 Q388L probably benign Het
Hcar2 C T 5: 123,865,333 V36M possibly damaging Het
Ifit3b A T 19: 34,612,555 D377V possibly damaging Het
Ints5 A G 19: 8,896,804 D709G probably benign Het
Lyst A G 13: 13,669,865 E1880G probably benign Het
Mep1a C T 17: 43,479,174 S428N probably benign Het
Mllt6 T C 11: 97,676,964 L739P probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Mmel1 T C 4: 154,871,654 M1T probably null Het
Muc5ac C T 7: 141,809,383 P2144S unknown Het
Myh4 T C 11: 67,240,930 V72A probably benign Het
Naa15 T A 3: 51,469,974 probably null Het
Nlrc5 A G 8: 94,521,400 probably null Het
Nme8 T A 13: 19,650,975 M514L probably benign Het
Nudt9 C A 5: 104,047,080 S14* probably null Het
Olfr538 T C 7: 140,574,246 F31S probably damaging Het
Olfr748 A T 14: 50,710,758 I143F possibly damaging Het
Optn G A 2: 5,054,650 T19I probably benign Het
Osbpl8 T A 10: 111,276,509 L495* probably null Het
Panx2 T C 15: 89,067,770 S147P possibly damaging Het
Pclo T A 5: 14,680,616 V3044D unknown Het
Pcnt T C 10: 76,422,808 K608E probably benign Het
Pde7a T A 3: 19,227,745 N447I probably damaging Het
Peli2 G T 14: 48,280,034 C186F not run Het
Pgm5 A G 19: 24,727,851 F433L probably benign Het
Plce1 G A 19: 38,748,433 V1588I probably benign Het
Plin4 T A 17: 56,102,413 H1295L probably benign Het
Poli T C 18: 70,525,519 E134G probably benign Het
Pramef6 T A 4: 143,897,801 D42V probably benign Het
Ptprq T A 10: 107,643,978 I1144F probably damaging Het
Ptprz1 A T 6: 23,024,978 T1738S probably damaging Het
Pxdc1 A G 13: 34,652,284 L51P probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhd T A 4: 134,884,509 probably null Het
Scn7a C T 2: 66,676,192 C1451Y probably damaging Het
Sdr39u1 G A 14: 55,897,734 R251* probably null Het
Sephs2 G T 7: 127,273,334 P196T possibly damaging Het
Slc22a16 T C 10: 40,574,089 Y195H possibly damaging Het
Spg11 C A 2: 122,068,880 V1575F probably damaging Het
Sqle C T 15: 59,316,041 S66L probably benign Het
Tas2r124 T G 6: 132,755,093 W122G probably damaging Het
Tex52 A T 6: 128,384,958 probably null Het
Thoc1 T A 18: 9,993,454 C604* probably null Het
Tmc3 T C 7: 83,597,458 S136P probably damaging Het
Tmem212 T A 3: 27,896,313 T11S probably benign Het
Ubn2 A G 6: 38,491,792 N1147S probably benign Het
Uggt2 A G 14: 119,075,347 I350T probably damaging Het
Ust A T 10: 8,207,575 Y346N probably damaging Het
Vwa8 A G 14: 79,098,300 T1399A probably benign Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp800 C A 6: 28,244,194 K257N probably damaging Het
Zfp985 T A 4: 147,582,874 D66E probably benign Het
Other mutations in Rpp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00424:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00478:Rpp14 APN 14 8083934 missense possibly damaging 0.78
IGL00538:Rpp14 APN 14 8083934 missense possibly damaging 0.78
R1167:Rpp14 UTSW 14 8083705 splice site probably null
R1499:Rpp14 UTSW 14 8090528 missense probably benign 0.18
R1874:Rpp14 UTSW 14 8090145 missense probably benign
R4778:Rpp14 UTSW 14 8090203 missense probably benign 0.08
R5222:Rpp14 UTSW 14 8087513 missense probably damaging 0.96
R5561:Rpp14 UTSW 14 8090558 unclassified probably null
R6015:Rpp14 UTSW 14 8090462 missense probably benign 0.00
R6801:Rpp14 UTSW 14 8083717 start gained probably benign
R7643:Rpp14 UTSW 14 8090325 nonsense probably null
R7872:Rpp14 UTSW 14 8083724 start codon destroyed probably null 0.00
R8259:Rpp14 UTSW 14 8090526 missense probably null 0.94
Z1088:Rpp14 UTSW 14 8090539 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAAAGACAATTGTTCACGG -3'
(R):5'- ACCAATCTGGAAGTCTCCCC -3'

Sequencing Primer
(F):5'- GTTCACGGAGTTTTGATAAATGGAC -3'
(R):5'- TGGATATACCAGCATTCCTCCAGG -3'
Posted On2019-11-12