Incidental Mutation 'R7685:Or11h23'
ID 593032
Institutional Source Beutler Lab
Gene Symbol Or11h23
Ensembl Gene ENSMUSG00000060084
Gene Name olfactory receptor family 11 subfamily G member 23
Synonyms GA_x6K02T2PMLR-6454789-6455712, Olfr748, MOR106-9P
MMRRC Submission 045750-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7685 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50947789-50948712 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 50948215 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 143 (I143F)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
AlphaFold E9Q9Z0
Predicted Effect possibly damaging
Transcript: ENSMUST00000073561
AA Change: I143F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: I143F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213101
AA Change: I143F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 105,116,081 (GRCm39) L251S probably damaging Het
Acsbg1 C T 9: 54,535,843 (GRCm39) S53N unknown Het
Adamts18 A G 8: 114,439,855 (GRCm39) C913R probably damaging Het
Adck5 C A 15: 76,479,588 (GRCm39) Y524* probably null Het
Adgrv1 G T 13: 81,251,443 (GRCm39) Q6225K possibly damaging Het
Ahr T C 12: 35,554,016 (GRCm39) N701S probably damaging Het
Apc T C 18: 34,447,261 (GRCm39) C1386R probably damaging Het
Bbs1 A G 19: 4,956,182 (GRCm39) S38P probably benign Het
Celsr1 G T 15: 85,862,933 (GRCm39) C1366* probably null Het
Cep290 A C 10: 100,375,919 (GRCm39) H1424P probably benign Het
Clcn3 C T 8: 61,386,119 (GRCm39) R311K possibly damaging Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Dhx9 A G 1: 153,334,152 (GRCm39) Y1002H probably damaging Het
Dnah8 C T 17: 30,876,947 (GRCm39) T533I probably damaging Het
Ermard T C 17: 15,279,724 (GRCm39) S505P probably benign Het
Fbxw17 G A 13: 50,579,680 (GRCm39) D166N probably damaging Het
Fmo3 T C 1: 162,785,901 (GRCm39) K363R possibly damaging Het
Frey1 C A 2: 92,213,817 (GRCm39) P68Q probably damaging Het
Gadd45gip1 A T 8: 85,558,980 (GRCm39) R21W probably damaging Het
Galnt4 A G 10: 98,945,826 (GRCm39) N517S probably benign Het
Ganc T A 2: 120,264,273 (GRCm39) W409R probably damaging Het
Glrx3 T C 7: 137,060,920 (GRCm39) S185P probably damaging Het
Gm49368 T C 7: 127,712,414 (GRCm39) S853P probably damaging Het
Gtf3c2 A C 5: 31,325,611 (GRCm39) L443V probably damaging Het
Gxylt2 A T 6: 100,781,489 (GRCm39) Q388L probably benign Het
Hcar2 C T 5: 124,003,396 (GRCm39) V36M possibly damaging Het
Ifit3b A T 19: 34,589,955 (GRCm39) D377V possibly damaging Het
Ints5 A G 19: 8,874,168 (GRCm39) D709G probably benign Het
Lyst A G 13: 13,844,450 (GRCm39) E1880G probably benign Het
Mep1a C T 17: 43,790,065 (GRCm39) S428N probably benign Het
Mllt6 T C 11: 97,567,790 (GRCm39) L739P probably damaging Het
Mlst8 T C 17: 24,695,031 (GRCm39) Y284C probably damaging Het
Mmel1 T C 4: 154,956,111 (GRCm39) M1T probably null Het
Muc5ac C T 7: 141,363,120 (GRCm39) P2144S unknown Het
Myh4 T C 11: 67,131,756 (GRCm39) V72A probably benign Het
Naa15 T A 3: 51,377,395 (GRCm39) probably null Het
Nlrc5 A G 8: 95,248,028 (GRCm39) probably null Het
Nme8 T A 13: 19,835,145 (GRCm39) M514L probably benign Het
Nudt9 C A 5: 104,194,946 (GRCm39) S14* probably null Het
Optn G A 2: 5,059,461 (GRCm39) T19I probably benign Het
Or13a24 T C 7: 140,154,159 (GRCm39) F31S probably damaging Het
Osbpl8 T A 10: 111,112,370 (GRCm39) L495* probably null Het
Panx2 T C 15: 88,951,973 (GRCm39) S147P possibly damaging Het
Pclo T A 5: 14,730,630 (GRCm39) V3044D unknown Het
Pcnt T C 10: 76,258,642 (GRCm39) K608E probably benign Het
Pde7a T A 3: 19,281,909 (GRCm39) N447I probably damaging Het
Peli2 G T 14: 48,517,491 (GRCm39) C186F not run Het
Pgm5 A G 19: 24,705,215 (GRCm39) F433L probably benign Het
Plce1 G A 19: 38,736,877 (GRCm39) V1588I probably benign Het
Plin4 T A 17: 56,409,413 (GRCm39) H1295L probably benign Het
Poli T C 18: 70,658,590 (GRCm39) E134G probably benign Het
Pramel11 T A 4: 143,624,371 (GRCm39) D42V probably benign Het
Ptprq T A 10: 107,479,839 (GRCm39) I1144F probably damaging Het
Ptprz1 A T 6: 23,024,977 (GRCm39) T1738S probably damaging Het
Pxdc1 A G 13: 34,836,267 (GRCm39) L51P probably damaging Het
Rabepk C T 2: 34,669,308 (GRCm39) G362S probably damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rhd T A 4: 134,611,820 (GRCm39) probably null Het
Rpp14 T C 14: 8,090,453 (GRCm38) S126P probably damaging Het
Scn7a C T 2: 66,506,536 (GRCm39) C1451Y probably damaging Het
Sdr39u1 G A 14: 56,135,191 (GRCm39) R251* probably null Het
Sephs2 G T 7: 126,872,506 (GRCm39) P196T possibly damaging Het
Slc22a16 T C 10: 40,450,085 (GRCm39) Y195H possibly damaging Het
Spg11 C A 2: 121,899,361 (GRCm39) V1575F probably damaging Het
Sqle C T 15: 59,187,890 (GRCm39) S66L probably benign Het
Tas2r124 T G 6: 132,732,056 (GRCm39) W122G probably damaging Het
Tex52 A T 6: 128,361,921 (GRCm39) probably null Het
Thoc1 T A 18: 9,993,454 (GRCm39) C604* probably null Het
Tmc3 T C 7: 83,246,666 (GRCm39) S136P probably damaging Het
Tmem212 T A 3: 27,950,462 (GRCm39) T11S probably benign Het
Ubn2 A G 6: 38,468,727 (GRCm39) N1147S probably benign Het
Uggt2 A G 14: 119,312,759 (GRCm39) I350T probably damaging Het
Ust A T 10: 8,083,339 (GRCm39) Y346N probably damaging Het
Vwa8 A G 14: 79,335,740 (GRCm39) T1399A probably benign Het
Zc3h18 G A 8: 123,140,615 (GRCm39) R850Q unknown Het
Zfp800 C A 6: 28,244,193 (GRCm39) K257N probably damaging Het
Zfp985 T A 4: 147,667,331 (GRCm39) D66E probably benign Het
Other mutations in Or11h23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Or11h23 APN 14 50,948,450 (GRCm39) missense possibly damaging 0.95
IGL02965:Or11h23 APN 14 50,948,653 (GRCm39) missense probably damaging 1.00
R0576:Or11h23 UTSW 14 50,948,661 (GRCm39) missense probably damaging 0.98
R1184:Or11h23 UTSW 14 50,948,071 (GRCm39) missense probably benign 0.01
R2129:Or11h23 UTSW 14 50,948,093 (GRCm39) missense probably damaging 0.99
R2895:Or11h23 UTSW 14 50,947,973 (GRCm39) missense probably damaging 0.99
R2896:Or11h23 UTSW 14 50,947,973 (GRCm39) missense probably damaging 0.99
R4017:Or11h23 UTSW 14 50,948,333 (GRCm39) missense probably benign 0.03
R5053:Or11h23 UTSW 14 50,947,968 (GRCm39) nonsense probably null
R5057:Or11h23 UTSW 14 50,948,669 (GRCm39) missense probably damaging 1.00
R5113:Or11h23 UTSW 14 50,948,371 (GRCm39) missense probably benign 0.00
R5294:Or11h23 UTSW 14 50,948,236 (GRCm39) missense probably benign 0.01
R5294:Or11h23 UTSW 14 50,947,900 (GRCm39) missense possibly damaging 0.95
R5499:Or11h23 UTSW 14 50,948,324 (GRCm39) missense probably damaging 1.00
R5582:Or11h23 UTSW 14 50,948,425 (GRCm39) missense probably damaging 1.00
R5727:Or11h23 UTSW 14 50,947,817 (GRCm39) missense possibly damaging 0.74
R6797:Or11h23 UTSW 14 50,948,563 (GRCm39) missense probably damaging 1.00
R7717:Or11h23 UTSW 14 50,948,219 (GRCm39) missense probably damaging 1.00
R7778:Or11h23 UTSW 14 50,947,928 (GRCm39) missense possibly damaging 0.60
R8276:Or11h23 UTSW 14 50,948,287 (GRCm39) missense probably benign 0.28
R8839:Or11h23 UTSW 14 50,947,957 (GRCm39) missense possibly damaging 0.73
R9322:Or11h23 UTSW 14 50,948,507 (GRCm39) missense probably damaging 1.00
R9358:Or11h23 UTSW 14 50,947,802 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAACATGCTGGTCAACTCTC -3'
(R):5'- TCCAAGGATGTACAAACAGGTG -3'

Sequencing Primer
(F):5'- GGTCAACTCTCTTTCCAAAACTAAG -3'
(R):5'- ACAGGTGAGGACAATGAATATAGTAC -3'
Posted On 2019-11-12