Incidental Mutation 'R7685:Ermard'
ID593040
Institutional Source Beutler Lab
Gene Symbol Ermard
Ensembl Gene ENSMUSG00000036552
Gene NameER membrane associated RNA degradation
Synonyms2410011O22Rik, 2210404J11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7685 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15041208-15090044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15059462 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 505 (S505P)
Ref Sequence ENSEMBL: ENSMUSP00000095005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040594] [ENSMUST00000097393] [ENSMUST00000227252] [ENSMUST00000228803]
Predicted Effect probably benign
Transcript: ENSMUST00000040594
AA Change: S57P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043677
Gene: ENSMUSG00000036552
AA Change: S57P

DomainStartEndE-ValueType
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097393
AA Change: S505P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095005
Gene: ENSMUSG00000036552
AA Change: S505P

DomainStartEndE-ValueType
Pfam:DUF4209 133 214 3.1e-27 PFAM
low complexity region 390 399 N/A INTRINSIC
SCOP:g1pnb.1 429 478 4e-3 SMART
low complexity region 583 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227252
Predicted Effect probably benign
Transcript: ENSMUST00000228803
AA Change: S94P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 transmembrane domains near the C-terminus and is localized in the endoplasmic reticulum. Knockout of this gene in developing rat brain showed that it may be involved in neuronal migration. Mutations in this gene are associated with periventricular nodular heterotopia-6 (PVNH6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik C A 2: 92,383,472 P68Q probably damaging Het
Abcg3 A G 5: 104,968,215 L251S probably damaging Het
Acsbg1 C T 9: 54,628,559 S53N unknown Het
Adamts18 A G 8: 113,713,223 C913R probably damaging Het
Adck5 C A 15: 76,595,388 Y524* probably null Het
Adgrv1 G T 13: 81,103,324 Q6225K possibly damaging Het
Ahr T C 12: 35,504,017 N701S probably damaging Het
Apc T C 18: 34,314,208 C1386R probably damaging Het
Bbs1 A G 19: 4,906,154 S38P probably benign Het
Celsr1 G T 15: 85,978,732 C1366* probably null Het
Cep290 A C 10: 100,540,057 H1424P probably benign Het
Clcn3 C T 8: 60,933,085 R311K possibly damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dhx9 A G 1: 153,458,406 Y1002H probably damaging Het
Dnah8 C T 17: 30,657,973 T533I probably damaging Het
Fbxw17 G A 13: 50,425,644 D166N probably damaging Het
Fmo3 T C 1: 162,958,332 K363R possibly damaging Het
Gadd45gip1 A T 8: 84,832,351 R21W probably damaging Het
Galnt4 A G 10: 99,109,964 N517S probably benign Het
Ganc T A 2: 120,433,792 W409R probably damaging Het
Glrx3 T C 7: 137,459,191 S185P probably damaging Het
Gm49368 T C 7: 128,113,242 S853P probably damaging Het
Gtf3c2 A C 5: 31,168,267 L443V probably damaging Het
Gxylt2 A T 6: 100,804,528 Q388L probably benign Het
Hcar2 C T 5: 123,865,333 V36M possibly damaging Het
Ifit3b A T 19: 34,612,555 D377V possibly damaging Het
Ints5 A G 19: 8,896,804 D709G probably benign Het
Lyst A G 13: 13,669,865 E1880G probably benign Het
Mep1a C T 17: 43,479,174 S428N probably benign Het
Mllt6 T C 11: 97,676,964 L739P probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Mmel1 T C 4: 154,871,654 M1T probably null Het
Muc5ac C T 7: 141,809,383 P2144S unknown Het
Myh4 T C 11: 67,240,930 V72A probably benign Het
Naa15 T A 3: 51,469,974 probably null Het
Nlrc5 A G 8: 94,521,400 probably null Het
Nme8 T A 13: 19,650,975 M514L probably benign Het
Nudt9 C A 5: 104,047,080 S14* probably null Het
Olfr538 T C 7: 140,574,246 F31S probably damaging Het
Olfr748 A T 14: 50,710,758 I143F possibly damaging Het
Optn G A 2: 5,054,650 T19I probably benign Het
Osbpl8 T A 10: 111,276,509 L495* probably null Het
Panx2 T C 15: 89,067,770 S147P possibly damaging Het
Pclo T A 5: 14,680,616 V3044D unknown Het
Pcnt T C 10: 76,422,808 K608E probably benign Het
Pde7a T A 3: 19,227,745 N447I probably damaging Het
Peli2 G T 14: 48,280,034 C186F not run Het
Pgm5 A G 19: 24,727,851 F433L probably benign Het
Plce1 G A 19: 38,748,433 V1588I probably benign Het
Plin4 T A 17: 56,102,413 H1295L probably benign Het
Poli T C 18: 70,525,519 E134G probably benign Het
Pramef6 T A 4: 143,897,801 D42V probably benign Het
Ptprq T A 10: 107,643,978 I1144F probably damaging Het
Ptprz1 A T 6: 23,024,978 T1738S probably damaging Het
Pxdc1 A G 13: 34,652,284 L51P probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhd T A 4: 134,884,509 probably null Het
Rpp14 T C 14: 8,090,453 S126P probably damaging Het
Scn7a C T 2: 66,676,192 C1451Y probably damaging Het
Sdr39u1 G A 14: 55,897,734 R251* probably null Het
Sephs2 G T 7: 127,273,334 P196T possibly damaging Het
Slc22a16 T C 10: 40,574,089 Y195H possibly damaging Het
Spg11 C A 2: 122,068,880 V1575F probably damaging Het
Sqle C T 15: 59,316,041 S66L probably benign Het
Tas2r124 T G 6: 132,755,093 W122G probably damaging Het
Tex52 A T 6: 128,384,958 probably null Het
Thoc1 T A 18: 9,993,454 C604* probably null Het
Tmc3 T C 7: 83,597,458 S136P probably damaging Het
Tmem212 T A 3: 27,896,313 T11S probably benign Het
Ubn2 A G 6: 38,491,792 N1147S probably benign Het
Uggt2 A G 14: 119,075,347 I350T probably damaging Het
Ust A T 10: 8,207,575 Y346N probably damaging Het
Vwa8 A G 14: 79,098,300 T1399A probably benign Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp800 C A 6: 28,244,194 K257N probably damaging Het
Zfp985 T A 4: 147,582,874 D66E probably benign Het
Other mutations in Ermard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ermard APN 17 14988066 splice site probably benign
IGL01554:Ermard APN 17 15051593 missense possibly damaging 0.94
IGL01832:Ermard APN 17 15059849 missense probably damaging 0.98
IGL02045:Ermard APN 17 15051564 unclassified probably benign
IGL02332:Ermard APN 17 14990545 critical splice acceptor site probably null
IGL02525:Ermard APN 17 15059339 splice site probably benign
IGL03335:Ermard APN 17 15059406 missense probably damaging 1.00
Eminence UTSW 17 15053205 splice site probably null
PIT4504001:Ermard UTSW 17 15058822 nonsense probably null
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0722:Ermard UTSW 17 15022128 missense probably benign 0.13
R0785:Ermard UTSW 17 15021977 missense probably damaging 1.00
R2019:Ermard UTSW 17 15053265 missense probably damaging 1.00
R3696:Ermard UTSW 17 15053376 missense probably benign 0.01
R3697:Ermard UTSW 17 15053376 missense probably benign 0.01
R4077:Ermard UTSW 17 15053376 missense probably benign 0.04
R4383:Ermard UTSW 17 15059866 missense possibly damaging 0.87
R5424:Ermard UTSW 17 15059770 missense possibly damaging 0.73
R6313:Ermard UTSW 17 15053205 splice site probably null
R7800:Ermard UTSW 17 15056803 missense probably benign 0.01
R7802:Ermard UTSW 17 15061161 missense probably benign
R7895:Ermard UTSW 17 15063613 missense possibly damaging 0.66
R7978:Ermard UTSW 17 15063613 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CCAAGTTTTAGATGAAGGTTACTGTGC -3'
(R):5'- AGTGAACAGGGTACACTCGTG -3'

Sequencing Primer
(F):5'- AGATGAAGGTTACTGTGCATTAAAC -3'
(R):5'- GTGTGACTCACTAGATACACACGTG -3'
Posted On2019-11-12