Mutagenetix > Incidental Mutation

Incidental Mutation 'R7685:Dnah8'

593042

Institutional Source

Beutler Lab

Gene Symbol

Dnah8

Ensembl Gene

ENSMUSG00000033826

Gene Name

dynein, axonemal, heavy chain 8

Synonyms

Dnahc8, P1-Loop, Hst6.7b

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R7685 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30624354-30875264 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30657973 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 533 (T533I)

Ref Sequence

ENSEMBL: ENSMUSP00000127878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170651]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170651
AA Change: T533I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: T533I

Domain	Start	End	E-Value	Type
low complexity region	2	54	N/A	INTRINSIC
Pfam:DHC_N1	379	936	8.4e-159	PFAM
low complexity region	1069	1080	N/A	INTRINSIC
low complexity region	1224	1237	N/A	INTRINSIC
Pfam:DHC_N2	1509	1917	1.6e-134	PFAM
AAA	2082	2226	1.38e-1	SMART
AAA	2363	2516	2.04e-1	SMART
AAA	2689	2837	8.15e-2	SMART
Pfam:AAA_8	3022	3294	4e-72	PFAM
Pfam:MT	3306	3656	3.6e-48	PFAM
Pfam:AAA_9	3676	3901	6.7e-85	PFAM
Pfam:Dynein_heavy	4039	4728	8.4e-250	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029I15Rik	C	A	2: 92,383,472	P68Q	probably damaging	Het
Abcg3	A	G	5: 104,968,215	L251S	probably damaging	Het
Acsbg1	C	T	9: 54,628,559	S53N	unknown	Het
Adamts18	A	G	8: 113,713,223	C913R	probably damaging	Het
Adck5	C	A	15: 76,595,388	Y524*	probably null	Het
Adgrv1	G	T	13: 81,103,324	Q6225K	possibly damaging	Het
Ahr	T	C	12: 35,504,017	N701S	probably damaging	Het
Apc	T	C	18: 34,314,208	C1386R	probably damaging	Het
Bbs1	A	G	19: 4,906,154	S38P	probably benign	Het
Celsr1	G	T	15: 85,978,732	C1366*	probably null	Het
Cep290	A	C	10: 100,540,057	H1424P	probably benign	Het
Clcn3	C	T	8: 60,933,085	R311K	possibly damaging	Het
Crat	C	T	2: 30,404,565	R497Q	probably benign	Het
Dhx9	A	G	1: 153,458,406	Y1002H	probably damaging	Het
Ermard	T	C	17: 15,059,462	S505P	probably benign	Het
Fbxw17	G	A	13: 50,425,644	D166N	probably damaging	Het
Fmo3	T	C	1: 162,958,332	K363R	possibly damaging	Het
Gadd45gip1	A	T	8: 84,832,351	R21W	probably damaging	Het
Galnt4	A	G	10: 99,109,964	N517S	probably benign	Het
Ganc	T	A	2: 120,433,792	W409R	probably damaging	Het
Glrx3	T	C	7: 137,459,191	S185P	probably damaging	Het
Gm49368	T	C	7: 128,113,242	S853P	probably damaging	Het
Gtf3c2	A	C	5: 31,168,267	L443V	probably damaging	Het
Gxylt2	A	T	6: 100,804,528	Q388L	probably benign	Het
Hcar2	C	T	5: 123,865,333	V36M	possibly damaging	Het
Ifit3b	A	T	19: 34,612,555	D377V	possibly damaging	Het
Ints5	A	G	19: 8,896,804	D709G	probably benign	Het
Lyst	A	G	13: 13,669,865	E1880G	probably benign	Het
Mep1a	C	T	17: 43,479,174	S428N	probably benign	Het
Mllt6	T	C	11: 97,676,964	L739P	probably damaging	Het
Mlst8	T	C	17: 24,476,057	Y284C	probably damaging	Het
Mmel1	T	C	4: 154,871,654	M1T	probably null	Het
Muc5ac	C	T	7: 141,809,383	P2144S	unknown	Het
Myh4	T	C	11: 67,240,930	V72A	probably benign	Het
Naa15	T	A	3: 51,469,974		probably null	Het
Nlrc5	A	G	8: 94,521,400		probably null	Het
Nme8	T	A	13: 19,650,975	M514L	probably benign	Het
Nudt9	C	A	5: 104,047,080	S14*	probably null	Het
Olfr538	T	C	7: 140,574,246	F31S	probably damaging	Het
Olfr748	A	T	14: 50,710,758	I143F	possibly damaging	Het
Optn	G	A	2: 5,054,650	T19I	probably benign	Het
Osbpl8	T	A	10: 111,276,509	L495*	probably null	Het
Panx2	T	C	15: 89,067,770	S147P	possibly damaging	Het
Pclo	T	A	5: 14,680,616	V3044D	unknown	Het
Pcnt	T	C	10: 76,422,808	K608E	probably benign	Het
Pde7a	T	A	3: 19,227,745	N447I	probably damaging	Het
Peli2	G	T	14: 48,280,034	C186F	not run	Het
Pgm5	A	G	19: 24,727,851	F433L	probably benign	Het
Plce1	G	A	19: 38,748,433	V1588I	probably benign	Het
Plin4	T	A	17: 56,102,413	H1295L	probably benign	Het
Poli	T	C	18: 70,525,519	E134G	probably benign	Het
Pramef6	T	A	4: 143,897,801	D42V	probably benign	Het
Ptprq	T	A	10: 107,643,978	I1144F	probably damaging	Het
Ptprz1	A	T	6: 23,024,978	T1738S	probably damaging	Het
Pxdc1	A	G	13: 34,652,284	L51P	probably damaging	Het
Rabepk	C	T	2: 34,779,296	G362S	probably damaging	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Rhd	T	A	4: 134,884,509		probably null	Het
Rpp14	T	C	14: 8,090,453	S126P	probably damaging	Het
Scn7a	C	T	2: 66,676,192	C1451Y	probably damaging	Het
Sdr39u1	G	A	14: 55,897,734	R251*	probably null	Het
Sephs2	G	T	7: 127,273,334	P196T	possibly damaging	Het
Slc22a16	T	C	10: 40,574,089	Y195H	possibly damaging	Het
Spg11	C	A	2: 122,068,880	V1575F	probably damaging	Het
Sqle	C	T	15: 59,316,041	S66L	probably benign	Het
Tas2r124	T	G	6: 132,755,093	W122G	probably damaging	Het
Tex52	A	T	6: 128,384,958		probably null	Het
Thoc1	T	A	18: 9,993,454	C604*	probably null	Het
Tmc3	T	C	7: 83,597,458	S136P	probably damaging	Het
Tmem212	T	A	3: 27,896,313	T11S	probably benign	Het
Ubn2	A	G	6: 38,491,792	N1147S	probably benign	Het
Uggt2	A	G	14: 119,075,347	I350T	probably damaging	Het
Ust	A	T	10: 8,207,575	Y346N	probably damaging	Het
Vwa8	A	G	14: 79,098,300	T1399A	probably benign	Het
Zc3h18	G	A	8: 122,413,876	R850Q	unknown	Het
Zfp800	C	A	6: 28,244,194	K257N	probably damaging	Het
Zfp985	T	A	4: 147,582,874	D66E	probably benign	Het

Other mutations in Dnah8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Dnah8	APN	17	30677176	missense	probably benign	0.06
IGL00508:Dnah8	APN	17	30855930	missense	probably damaging	1.00
IGL00547:Dnah8	APN	17	30815703	nonsense	probably null
IGL00551:Dnah8	APN	17	30663478	nonsense	probably null
IGL00732:Dnah8	APN	17	30656641	missense	probably damaging	1.00
IGL00775:Dnah8	APN	17	30767906	nonsense	probably null
IGL00840:Dnah8	APN	17	30790941	missense	probably damaging	1.00
IGL00845:Dnah8	APN	17	30819276	critical splice donor site	probably null
IGL00953:Dnah8	APN	17	30706457	nonsense	probably null
IGL00976:Dnah8	APN	17	30851710	missense	probably damaging	0.98
IGL01395:Dnah8	APN	17	30636005	missense	probably benign	0.06
IGL01467:Dnah8	APN	17	30779916	missense	probably damaging	1.00
IGL01469:Dnah8	APN	17	30683714	splice site	probably benign
IGL01515:Dnah8	APN	17	30648485	missense	probably benign
IGL01723:Dnah8	APN	17	30708471	missense	probably damaging	1.00
IGL01837:Dnah8	APN	17	30751591	critical splice donor site	probably null
IGL01921:Dnah8	APN	17	30736141	missense	probably benign
IGL01958:Dnah8	APN	17	30855895	splice site	probably benign
IGL01968:Dnah8	APN	17	30656598	nonsense	probably null
IGL02093:Dnah8	APN	17	30717880	missense	probably damaging	0.99
IGL02151:Dnah8	APN	17	30648417	missense	possibly damaging	0.50
IGL02182:Dnah8	APN	17	30794763	missense	possibly damaging	0.45
IGL02233:Dnah8	APN	17	30706513	critical splice donor site	probably null
IGL02236:Dnah8	APN	17	30649773	nonsense	probably null
IGL02259:Dnah8	APN	17	30759614	missense	probably benign
IGL02263:Dnah8	APN	17	30729165	missense	probably benign	0.00
IGL02303:Dnah8	APN	17	30713047	missense	probably benign	0.03
IGL02341:Dnah8	APN	17	30747257	missense	probably damaging	1.00
IGL02351:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02358:Dnah8	APN	17	30767811	missense	probably damaging	1.00
IGL02377:Dnah8	APN	17	30794796	missense	probably damaging	0.98
IGL02390:Dnah8	APN	17	30830845	missense	probably benign	0.01
IGL02392:Dnah8	APN	17	30818051	splice site	probably benign
IGL02414:Dnah8	APN	17	30700413	missense	probably benign
IGL02455:Dnah8	APN	17	30672334	missense	probably damaging	0.99
IGL02817:Dnah8	APN	17	30668295	missense	probably benign
IGL02831:Dnah8	APN	17	30712276	missense	probably benign	0.23
IGL02863:Dnah8	APN	17	30769697	missense	probably damaging	1.00
IGL02894:Dnah8	APN	17	30721110	nonsense	probably null
IGL02954:Dnah8	APN	17	30704835	missense	probably benign	0.30
IGL02964:Dnah8	APN	17	30746761	missense	probably damaging	1.00
IGL03080:Dnah8	APN	17	30719006	missense	probably benign	0.01
IGL03081:Dnah8	APN	17	30686373	splice site	probably benign
IGL03086:Dnah8	APN	17	30742780	missense	probably damaging	1.00
IGL03087:Dnah8	APN	17	30784144	missense	probably benign
IGL03176:Dnah8	APN	17	30694037	missense	probably benign
IGL03191:Dnah8	APN	17	30726830	missense	probably damaging	0.99
IGL03210:Dnah8	APN	17	30815665	missense	probably damaging	0.96
IGL03252:Dnah8	APN	17	30673920	splice site	probably null
IGL03255:Dnah8	APN	17	30741381	missense	probably damaging	1.00
IGL03288:Dnah8	APN	17	30672349	missense	probably benign
IGL03348:Dnah8	APN	17	30746986	missense	probably damaging	0.99
Alternator	UTSW	17	30765635	missense	probably benign
armature	UTSW	17	30708390	missense	probably benign	0.02
Brush	UTSW	17	30746990	missense	probably damaging	1.00
Dynos	UTSW	17	30715509	missense	possibly damaging	0.84
joule	UTSW	17	30713098	critical splice donor site	probably null
solenoid	UTSW	17	30741178	missense	probably damaging	1.00
FR4340:Dnah8	UTSW	17	30635463	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635465	small deletion	probably benign
FR4737:Dnah8	UTSW	17	30635477	small deletion	probably benign
I2288:Dnah8	UTSW	17	30663454	missense	probably benign
P0029:Dnah8	UTSW	17	30765720	missense	probably damaging	1.00
PIT4812001:Dnah8	UTSW	17	30708445	missense	probably benign	0.04
R0016:Dnah8	UTSW	17	30663316	missense	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0035:Dnah8	UTSW	17	30683621	splice site	probably benign
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0062:Dnah8	UTSW	17	30765711	missense	probably damaging	1.00
R0087:Dnah8	UTSW	17	30755119	missense	probably damaging	1.00
R0090:Dnah8	UTSW	17	30784090	missense	probably benign	0.20
R0119:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0164:Dnah8	UTSW	17	30748665	missense	probably benign
R0184:Dnah8	UTSW	17	30683683	missense	probably benign	0.04
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0240:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0241:Dnah8	UTSW	17	30765679	missense	probably damaging	0.98
R0265:Dnah8	UTSW	17	30690271	missense	probably benign
R0268:Dnah8	UTSW	17	30769707	missense	probably damaging	1.00
R0282:Dnah8	UTSW	17	30736156	missense	probably damaging	1.00
R0299:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0334:Dnah8	UTSW	17	30871351	missense	probably damaging	0.99
R0393:Dnah8	UTSW	17	30708390	missense	probably benign	0.02
R0423:Dnah8	UTSW	17	30701981	missense	probably benign
R0470:Dnah8	UTSW	17	30708540	splice site	probably benign
R0477:Dnah8	UTSW	17	30755080	missense	probably damaging	1.00
R0490:Dnah8	UTSW	17	30700419	missense	probably benign
R0499:Dnah8	UTSW	17	30715509	missense	possibly damaging	0.84
R0582:Dnah8	UTSW	17	30718961	missense	probably benign	0.01
R0601:Dnah8	UTSW	17	30708358	missense	probably benign	0.06
R0646:Dnah8	UTSW	17	30684173	missense	probably damaging	0.97
R0665:Dnah8	UTSW	17	30736155	missense	probably damaging	0.99
R0800:Dnah8	UTSW	17	30704662	missense	probably benign
R0843:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R0940:Dnah8	UTSW	17	30803243	missense	probably damaging	1.00
R0964:Dnah8	UTSW	17	30673920	splice site	probably null
R1102:Dnah8	UTSW	17	30854764	splice site	probably null
R1137:Dnah8	UTSW	17	30855936	missense	probably damaging	1.00
R1342:Dnah8	UTSW	17	30721000	missense	probably damaging	0.99
R1375:Dnah8	UTSW	17	30737295	missense	probably damaging	1.00
R1377:Dnah8	UTSW	17	30840622	nonsense	probably null
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1464:Dnah8	UTSW	17	30695173	missense	possibly damaging	0.81
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1470:Dnah8	UTSW	17	30747277	nonsense	probably null
R1497:Dnah8	UTSW	17	30752075	missense	probably damaging	1.00
R1513:Dnah8	UTSW	17	30673888	missense	probably benign
R1541:Dnah8	UTSW	17	30747247	missense	probably damaging	1.00
R1563:Dnah8	UTSW	17	30635664	missense	probably benign	0.07
R1634:Dnah8	UTSW	17	30713098	critical splice donor site	probably null
R1670:Dnah8	UTSW	17	30725124	missense	probably damaging	1.00
R1710:Dnah8	UTSW	17	30854940	missense	probably damaging	1.00
R1743:Dnah8	UTSW	17	30769651	missense	probably benign	0.28
R1761:Dnah8	UTSW	17	30779916	missense	probably damaging	1.00
R1785:Dnah8	UTSW	17	30722937	missense	probably damaging	0.98
R1804:Dnah8	UTSW	17	30708407	missense	probably benign	0.00
R1808:Dnah8	UTSW	17	30684186	missense	probably damaging	1.00
R1824:Dnah8	UTSW	17	30731180	missense	possibly damaging	0.67
R1836:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R1935:Dnah8	UTSW	17	30635505	missense	unknown
R1935:Dnah8	UTSW	17	30726896	splice site	probably benign
R1940:Dnah8	UTSW	17	30731207	missense	probably damaging	1.00
R1946:Dnah8	UTSW	17	30712385	missense	probably benign	0.00
R2025:Dnah8	UTSW	17	30731159	missense	probably damaging	0.99
R2038:Dnah8	UTSW	17	30758281	missense	probably damaging	1.00
R2042:Dnah8	UTSW	17	30635658	missense	probably benign	0.01
R2148:Dnah8	UTSW	17	30737258	missense	probably damaging	1.00
R2177:Dnah8	UTSW	17	30653393	missense	probably benign
R2180:Dnah8	UTSW	17	30840647	missense	probably benign	0.00
R2262:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2263:Dnah8	UTSW	17	30673835	missense	probably damaging	1.00
R2328:Dnah8	UTSW	17	30794744	missense	probably damaging	1.00
R2357:Dnah8	UTSW	17	30771872	missense	probably benign
R2357:Dnah8	UTSW	17	30874935	missense	probably benign	0.00
R2360:Dnah8	UTSW	17	30677204	missense	probably benign	0.22
R2496:Dnah8	UTSW	17	30851731	missense	probably damaging	1.00
R2497:Dnah8	UTSW	17	30741365	nonsense	probably null
R2509:Dnah8	UTSW	17	30775045	missense	probably benign	0.02
R3114:Dnah8	UTSW	17	30833568	missense	probably benign	0.04
R3708:Dnah8	UTSW	17	30739657	missense	probably damaging	0.98
R3720:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3722:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3727:Dnah8	UTSW	17	30739648	nonsense	probably null
R3747:Dnah8	UTSW	17	30784174	nonsense	probably null
R3748:Dnah8	UTSW	17	30784174	nonsense	probably null
R3749:Dnah8	UTSW	17	30784174	nonsense	probably null
R3787:Dnah8	UTSW	17	30755041	missense	probably damaging	1.00
R3790:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3804:Dnah8	UTSW	17	30670647	missense	probably benign	0.00
R3857:Dnah8	UTSW	17	30663422	missense	probably damaging	0.96
R3898:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3899:Dnah8	UTSW	17	30854898	missense	probably damaging	1.00
R3938:Dnah8	UTSW	17	30854937	missense	probably damaging	1.00
R3943:Dnah8	UTSW	17	30694065	splice site	probably benign
R4091:Dnah8	UTSW	17	30769839	missense	probably damaging	1.00
R4291:Dnah8	UTSW	17	30748559	missense	probably benign
R4326:Dnah8	UTSW	17	30752092	missense	probably benign	0.04
R4346:Dnah8	UTSW	17	30725098	missense	possibly damaging	0.92
R4429:Dnah8	UTSW	17	30752146	missense	probably damaging	1.00
R4457:Dnah8	UTSW	17	30813151	missense	probably benign
R4475:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4565:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4566:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4568:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4573:Dnah8	UTSW	17	30700406	missense	probably benign	0.00
R4580:Dnah8	UTSW	17	30662052	missense	probably benign	0.00
R4585:Dnah8	UTSW	17	30751567	missense	probably benign	0.01
R4611:Dnah8	UTSW	17	30684237	missense	probably damaging	1.00
R4720:Dnah8	UTSW	17	30683634	missense	probably benign	0.08
R4721:Dnah8	UTSW	17	30725166	missense	probably damaging	1.00
R4727:Dnah8	UTSW	17	30851747	missense	probably damaging	1.00
R4731:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4732:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4733:Dnah8	UTSW	17	30775061	missense	probably null	0.02
R4798:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4814:Dnah8	UTSW	17	30767924	missense	probably damaging	1.00
R4892:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4894:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4900:Dnah8	UTSW	17	30746975	missense	probably damaging	1.00
R4901:Dnah8	UTSW	17	30840714	critical splice donor site	probably null
R4913:Dnah8	UTSW	17	30819139	missense	probably damaging	0.99
R4931:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4932:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4933:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R4942:Dnah8	UTSW	17	30729142	missense	probably benign
R4969:Dnah8	UTSW	17	30723014	missense	probably damaging	1.00
R4975:Dnah8	UTSW	17	30656985	missense	probably benign	0.12
R4977:Dnah8	UTSW	17	30663301	missense	probably benign	0.00
R5001:Dnah8	UTSW	17	30787185	missense	probably damaging	1.00
R5011:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5013:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5014:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5024:Dnah8	UTSW	17	30736096	missense	probably damaging	1.00
R5075:Dnah8	UTSW	17	30739757	critical splice donor site	probably null
R5075:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5075:Dnah8	UTSW	17	30800531	missense	probably damaging	1.00
R5112:Dnah8	UTSW	17	30731038	missense	probably benign	0.02
R5121:Dnah8	UTSW	17	30810353	missense	probably benign	0.14
R5138:Dnah8	UTSW	17	30765597	missense	probably damaging	0.99
R5151:Dnah8	UTSW	17	30712295	missense	probably benign	0.06
R5191:Dnah8	UTSW	17	30746765	missense	probably damaging	1.00
R5238:Dnah8	UTSW	17	30790917	missense	probably damaging	1.00
R5260:Dnah8	UTSW	17	30700419	missense	probably benign
R5358:Dnah8	UTSW	17	30746954	missense	probably damaging	1.00
R5403:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5404:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5482:Dnah8	UTSW	17	30800547	missense	probably damaging	0.96
R5489:Dnah8	UTSW	17	30790956	missense	probably damaging	1.00
R5513:Dnah8	UTSW	17	30752916	missense	probably damaging	0.99
R5635:Dnah8	UTSW	17	30706386	missense	probably benign	0.00
R5640:Dnah8	UTSW	17	30803108	missense	probably damaging	1.00
R5649:Dnah8	UTSW	17	30800587	missense	probably benign	0.13
R5662:Dnah8	UTSW	17	30737333	missense	probably damaging	1.00
R5673:Dnah8	UTSW	17	30803261	missense	probably damaging	1.00
R5677:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5699:Dnah8	UTSW	17	30810324	missense	probably benign	0.22
R5737:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5738:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R5739:Dnah8	UTSW	17	30719007	missense	probably benign	0.00
R5766:Dnah8	UTSW	17	30690261	missense	probably benign	0.01
R5790:Dnah8	UTSW	17	30875004	missense	probably damaging	0.98
R5848:Dnah8	UTSW	17	30728191	missense	possibly damaging	0.69
R5854:Dnah8	UTSW	17	30794763	missense	possibly damaging	0.45
R5885:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5886:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5887:Dnah8	UTSW	17	30794717	missense	probably damaging	1.00
R5899:Dnah8	UTSW	17	30656685	missense	probably benign	0.32
R5979:Dnah8	UTSW	17	30815664	nonsense	probably null
R5986:Dnah8	UTSW	17	30851630	missense	possibly damaging	0.83
R5999:Dnah8	UTSW	17	30663305	missense	probably benign	0.32
R6042:Dnah8	UTSW	17	30747265	missense	probably damaging	1.00
R6175:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6181:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6237:Dnah8	UTSW	17	30747854	nonsense	probably null
R6239:Dnah8	UTSW	17	30810359	missense	probably damaging	0.99
R6337:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6365:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6416:Dnah8	UTSW	17	30765635	missense	probably benign
R6443:Dnah8	UTSW	17	30771885	missense	probably benign	0.10
R6478:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6479:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6480:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6481:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6533:Dnah8	UTSW	17	30746990	missense	probably damaging	1.00
R6606:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6608:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6610:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6675:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6723:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6724:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6754:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6755:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6759:Dnah8	UTSW	17	30663292	splice site	probably null
R6765:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6766:Dnah8	UTSW	17	30748568	missense	probably benign	0.00
R6778:Dnah8	UTSW	17	30635666	missense	probably benign	0.00
R6781:Dnah8	UTSW	17	30765724	frame shift	probably null
R6788:Dnah8	UTSW	17	30648465	missense	probably benign	0.14
R6814:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6825:Dnah8	UTSW	17	30741173	missense	probably damaging	1.00
R6838:Dnah8	UTSW	17	30710551	missense	probably damaging	1.00
R6872:Dnah8	UTSW	17	30762679	missense	probably damaging	1.00
R6877:Dnah8	UTSW	17	30746959	missense	probably damaging	1.00
R6944:Dnah8	UTSW	17	30794659	missense	probably benign	0.09
R6982:Dnah8	UTSW	17	30767925	missense	probably benign	0.03
R6984:Dnah8	UTSW	17	30739738	missense	probably damaging	1.00
R6987:Dnah8	UTSW	17	30662091	missense	possibly damaging	0.95
R6988:Dnah8	UTSW	17	30643275	missense	probably damaging	1.00
R7099:Dnah8	UTSW	17	30704724	missense	possibly damaging	0.93
R7106:Dnah8	UTSW	17	30741178	missense	probably damaging	1.00
R7112:Dnah8	UTSW	17	30871392	missense	possibly damaging	0.79
R7146:Dnah8	UTSW	17	30644617	missense	probably benign	0.01
R7146:Dnah8	UTSW	17	30769644	missense	possibly damaging	0.90
R7309:Dnah8	UTSW	17	30875014	missense	probably damaging	1.00
R7324:Dnah8	UTSW	17	30784125	missense	probably benign	0.01
R7373:Dnah8	UTSW	17	30767965	critical splice donor site	probably null
R7423:Dnah8	UTSW	17	30704769	missense	possibly damaging	0.86
R7430:Dnah8	UTSW	17	30706389	missense	probably damaging	0.98
R7450:Dnah8	UTSW	17	30787191	missense	probably damaging	0.99
R7580:Dnah8	UTSW	17	30775103	missense	probably damaging	0.98
R7604:Dnah8	UTSW	17	30813095	missense	probably damaging	1.00
R7635:Dnah8	UTSW	17	30785107	missense	probably damaging	1.00
R7646:Dnah8	UTSW	17	30649677	missense	probably benign	0.00
R7793:Dnah8	UTSW	17	30855944	missense	probably benign	0.20
R7827:Dnah8	UTSW	17	30760867	frame shift	probably null
R7866:Dnah8	UTSW	17	30874927	missense	possibly damaging	0.94
R7877:Dnah8	UTSW	17	30663374	missense	probably benign
R7891:Dnah8	UTSW	17	30712289	missense	probably benign	0.09
R7977:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R7987:Dnah8	UTSW	17	30744524	missense	probably damaging	1.00
R8025:Dnah8	UTSW	17	30741337	nonsense	probably null
R8076:Dnah8	UTSW	17	30784153	missense	possibly damaging	0.94
R8170:Dnah8	UTSW	17	30673823	missense	probably damaging	1.00
R8199:Dnah8	UTSW	17	30871419	missense	probably benign	0.06
R8253:Dnah8	UTSW	17	30760867	frame shift	probably null
R8270:Dnah8	UTSW	17	30840713	missense	probably damaging	1.00
R8291:Dnah8	UTSW	17	30765727	missense	probably damaging	1.00
R8334:Dnah8	UTSW	17	30769831	missense	probably benign	0.12
R8348:Dnah8	UTSW	17	30673840	missense	probably benign
R8348:Dnah8	UTSW	17	30736147	missense	probably damaging	0.96
R8354:Dnah8	UTSW	17	30643260	missense	probably benign	0.17
R8355:Dnah8	UTSW	17	30695178	missense	possibly damaging	0.89
R8439:Dnah8	UTSW	17	30760867	frame shift	probably null
R8448:Dnah8	UTSW	17	30673840	missense	probably benign
R8459:Dnah8	UTSW	17	30725247	critical splice donor site	probably null
R8462:Dnah8	UTSW	17	30656629	missense	probably damaging	1.00
R8506:Dnah8	UTSW	17	30721134	missense	probably benign
R8524:Dnah8	UTSW	17	30715498	missense	possibly damaging	0.95
R8555:Dnah8	UTSW	17	30721110	nonsense	probably null
R8698:Dnah8	UTSW	17	30875035	missense	probably damaging	1.00
R8719:Dnah8	UTSW	17	30741315	missense	probably damaging	0.97
R8778:Dnah8	UTSW	17	30760867	frame shift	probably null
R8781:Dnah8	UTSW	17	30725104	missense	probably damaging	1.00
R8821:Dnah8	UTSW	17	30794738	missense	probably damaging	1.00
R8864:Dnah8	UTSW	17	30762642	missense	possibly damaging	0.95
R8885:Dnah8	UTSW	17	30708312	missense	possibly damaging	0.83
R8983:Dnah8	UTSW	17	30851654	missense	probably damaging	0.98
R8994:Dnah8	UTSW	17	30790833	missense	probably benign	0.05
R9031:Dnah8	UTSW	17	30737427	missense	probably damaging	1.00
R9068:Dnah8	UTSW	17	30756755	missense	possibly damaging	0.63
R9225:Dnah8	UTSW	17	30635673	missense	probably benign	0.01
R9280:Dnah8	UTSW	17	30785097	missense	possibly damaging	0.52
R9291:Dnah8	UTSW	17	30725125	missense	probably damaging	1.00
R9314:Dnah8	UTSW	17	30771883	missense	probably benign
R9347:Dnah8	UTSW	17	30708359	missense	probably benign	0.00
R9393:Dnah8	UTSW	17	30653387	missense	possibly damaging	0.53
R9415:Dnah8	UTSW	17	30810323	missense	probably benign	0.02
R9458:Dnah8	UTSW	17	30830803	missense	probably damaging	1.00
R9465:Dnah8	UTSW	17	30760867	frame shift	probably null
R9518:Dnah8	UTSW	17	30760867	frame shift	probably null
R9524:Dnah8	UTSW	17	30760867	frame shift	probably null
R9564:Dnah8	UTSW	17	30713047	missense	probably benign	0.07
R9587:Dnah8	UTSW	17	30760867	frame shift	probably null
R9599:Dnah8	UTSW	17	30760867	frame shift	probably null
R9641:Dnah8	UTSW	17	30713055	missense	probably benign	0.13
R9674:Dnah8	UTSW	17	30779138	missense	possibly damaging	0.84
R9679:Dnah8	UTSW	17	30818141	missense	probably benign
R9789:Dnah8	UTSW	17	30761130	critical splice donor site	probably null
RF027:Dnah8	UTSW	17	30635476	frame shift	probably null
X0001:Dnah8	UTSW	17	30748680	missense	probably damaging	1.00
X0013:Dnah8	UTSW	17	30819186	missense	possibly damaging	0.71
Z1176:Dnah8	UTSW	17	30648540	missense	probably benign
Z1177:Dnah8	UTSW	17	30694033	missense	probably benign
Z1177:Dnah8	UTSW	17	30713095	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTGGGAGTCATGACCCC -3'
(R):5'- AGGGAGCACGGTTTCATGAATG -3'

Sequencing Primer
(F):5'- CCCCAGGGACAGTGACATAATTG -3'
(R):5'- CACGGTTTCATGAATGAACAAAG -3'

Posted On

2019-11-12