Incidental Mutation 'R7685:Dnah8'
ID 593042
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms P1-Loop, Dnahc8, Hst6.7b
MMRRC Submission 045750-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.477) question?
Stock # R7685 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 30845909-31094736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30876947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 533 (T533I)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000170651
AA Change: T533I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: T533I

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 105,116,081 (GRCm39) L251S probably damaging Het
Acsbg1 C T 9: 54,535,843 (GRCm39) S53N unknown Het
Adamts18 A G 8: 114,439,855 (GRCm39) C913R probably damaging Het
Adck5 C A 15: 76,479,588 (GRCm39) Y524* probably null Het
Adgrv1 G T 13: 81,251,443 (GRCm39) Q6225K possibly damaging Het
Ahr T C 12: 35,554,016 (GRCm39) N701S probably damaging Het
Apc T C 18: 34,447,261 (GRCm39) C1386R probably damaging Het
Bbs1 A G 19: 4,956,182 (GRCm39) S38P probably benign Het
Celsr1 G T 15: 85,862,933 (GRCm39) C1366* probably null Het
Cep290 A C 10: 100,375,919 (GRCm39) H1424P probably benign Het
Clcn3 C T 8: 61,386,119 (GRCm39) R311K possibly damaging Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Dhx9 A G 1: 153,334,152 (GRCm39) Y1002H probably damaging Het
Ermard T C 17: 15,279,724 (GRCm39) S505P probably benign Het
Fbxw17 G A 13: 50,579,680 (GRCm39) D166N probably damaging Het
Fmo3 T C 1: 162,785,901 (GRCm39) K363R possibly damaging Het
Frey1 C A 2: 92,213,817 (GRCm39) P68Q probably damaging Het
Gadd45gip1 A T 8: 85,558,980 (GRCm39) R21W probably damaging Het
Galnt4 A G 10: 98,945,826 (GRCm39) N517S probably benign Het
Ganc T A 2: 120,264,273 (GRCm39) W409R probably damaging Het
Glrx3 T C 7: 137,060,920 (GRCm39) S185P probably damaging Het
Gm49368 T C 7: 127,712,414 (GRCm39) S853P probably damaging Het
Gtf3c2 A C 5: 31,325,611 (GRCm39) L443V probably damaging Het
Gxylt2 A T 6: 100,781,489 (GRCm39) Q388L probably benign Het
Hcar2 C T 5: 124,003,396 (GRCm39) V36M possibly damaging Het
Ifit3b A T 19: 34,589,955 (GRCm39) D377V possibly damaging Het
Ints5 A G 19: 8,874,168 (GRCm39) D709G probably benign Het
Lyst A G 13: 13,844,450 (GRCm39) E1880G probably benign Het
Mep1a C T 17: 43,790,065 (GRCm39) S428N probably benign Het
Mllt6 T C 11: 97,567,790 (GRCm39) L739P probably damaging Het
Mlst8 T C 17: 24,695,031 (GRCm39) Y284C probably damaging Het
Mmel1 T C 4: 154,956,111 (GRCm39) M1T probably null Het
Muc5ac C T 7: 141,363,120 (GRCm39) P2144S unknown Het
Myh4 T C 11: 67,131,756 (GRCm39) V72A probably benign Het
Naa15 T A 3: 51,377,395 (GRCm39) probably null Het
Nlrc5 A G 8: 95,248,028 (GRCm39) probably null Het
Nme8 T A 13: 19,835,145 (GRCm39) M514L probably benign Het
Nudt9 C A 5: 104,194,946 (GRCm39) S14* probably null Het
Optn G A 2: 5,059,461 (GRCm39) T19I probably benign Het
Or11h23 A T 14: 50,948,215 (GRCm39) I143F possibly damaging Het
Or13a24 T C 7: 140,154,159 (GRCm39) F31S probably damaging Het
Osbpl8 T A 10: 111,112,370 (GRCm39) L495* probably null Het
Panx2 T C 15: 88,951,973 (GRCm39) S147P possibly damaging Het
Pclo T A 5: 14,730,630 (GRCm39) V3044D unknown Het
Pcnt T C 10: 76,258,642 (GRCm39) K608E probably benign Het
Pde7a T A 3: 19,281,909 (GRCm39) N447I probably damaging Het
Peli2 G T 14: 48,517,491 (GRCm39) C186F not run Het
Pgm5 A G 19: 24,705,215 (GRCm39) F433L probably benign Het
Plce1 G A 19: 38,736,877 (GRCm39) V1588I probably benign Het
Plin4 T A 17: 56,409,413 (GRCm39) H1295L probably benign Het
Poli T C 18: 70,658,590 (GRCm39) E134G probably benign Het
Pramel11 T A 4: 143,624,371 (GRCm39) D42V probably benign Het
Ptprq T A 10: 107,479,839 (GRCm39) I1144F probably damaging Het
Ptprz1 A T 6: 23,024,977 (GRCm39) T1738S probably damaging Het
Pxdc1 A G 13: 34,836,267 (GRCm39) L51P probably damaging Het
Rabepk C T 2: 34,669,308 (GRCm39) G362S probably damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rhd T A 4: 134,611,820 (GRCm39) probably null Het
Rpp14 T C 14: 8,090,453 (GRCm38) S126P probably damaging Het
Scn7a C T 2: 66,506,536 (GRCm39) C1451Y probably damaging Het
Sdr39u1 G A 14: 56,135,191 (GRCm39) R251* probably null Het
Sephs2 G T 7: 126,872,506 (GRCm39) P196T possibly damaging Het
Slc22a16 T C 10: 40,450,085 (GRCm39) Y195H possibly damaging Het
Spg11 C A 2: 121,899,361 (GRCm39) V1575F probably damaging Het
Sqle C T 15: 59,187,890 (GRCm39) S66L probably benign Het
Tas2r124 T G 6: 132,732,056 (GRCm39) W122G probably damaging Het
Tex52 A T 6: 128,361,921 (GRCm39) probably null Het
Thoc1 T A 18: 9,993,454 (GRCm39) C604* probably null Het
Tmc3 T C 7: 83,246,666 (GRCm39) S136P probably damaging Het
Tmem212 T A 3: 27,950,462 (GRCm39) T11S probably benign Het
Ubn2 A G 6: 38,468,727 (GRCm39) N1147S probably benign Het
Uggt2 A G 14: 119,312,759 (GRCm39) I350T probably damaging Het
Ust A T 10: 8,083,339 (GRCm39) Y346N probably damaging Het
Vwa8 A G 14: 79,335,740 (GRCm39) T1399A probably benign Het
Zc3h18 G A 8: 123,140,615 (GRCm39) R850Q unknown Het
Zfp800 C A 6: 28,244,193 (GRCm39) K257N probably damaging Het
Zfp985 T A 4: 147,667,331 (GRCm39) D66E probably benign Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30,896,150 (GRCm39) missense probably benign 0.06
IGL00508:Dnah8 APN 17 31,074,904 (GRCm39) missense probably damaging 1.00
IGL00547:Dnah8 APN 17 31,034,677 (GRCm39) nonsense probably null
IGL00551:Dnah8 APN 17 30,882,452 (GRCm39) nonsense probably null
IGL00732:Dnah8 APN 17 30,875,615 (GRCm39) missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30,986,880 (GRCm39) nonsense probably null
IGL00840:Dnah8 APN 17 31,009,915 (GRCm39) missense probably damaging 1.00
IGL00845:Dnah8 APN 17 31,038,250 (GRCm39) critical splice donor site probably null
IGL00953:Dnah8 APN 17 30,925,431 (GRCm39) nonsense probably null
IGL00976:Dnah8 APN 17 31,070,684 (GRCm39) missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30,854,979 (GRCm39) missense probably benign 0.06
IGL01467:Dnah8 APN 17 30,998,890 (GRCm39) missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30,902,688 (GRCm39) splice site probably benign
IGL01515:Dnah8 APN 17 30,867,459 (GRCm39) missense probably benign
IGL01723:Dnah8 APN 17 30,927,445 (GRCm39) missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30,970,565 (GRCm39) critical splice donor site probably null
IGL01921:Dnah8 APN 17 30,955,115 (GRCm39) missense probably benign
IGL01958:Dnah8 APN 17 31,074,869 (GRCm39) splice site probably benign
IGL01968:Dnah8 APN 17 30,875,572 (GRCm39) nonsense probably null
IGL02093:Dnah8 APN 17 30,936,854 (GRCm39) missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30,867,391 (GRCm39) missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 31,013,737 (GRCm39) missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30,925,487 (GRCm39) critical splice donor site probably null
IGL02236:Dnah8 APN 17 30,868,747 (GRCm39) nonsense probably null
IGL02259:Dnah8 APN 17 30,978,588 (GRCm39) missense probably benign
IGL02263:Dnah8 APN 17 30,948,139 (GRCm39) missense probably benign 0.00
IGL02303:Dnah8 APN 17 30,932,021 (GRCm39) missense probably benign 0.03
IGL02341:Dnah8 APN 17 30,966,231 (GRCm39) missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02377:Dnah8 APN 17 31,013,770 (GRCm39) missense probably damaging 0.98
IGL02390:Dnah8 APN 17 31,049,819 (GRCm39) missense probably benign 0.01
IGL02392:Dnah8 APN 17 31,037,025 (GRCm39) splice site probably benign
IGL02414:Dnah8 APN 17 30,919,387 (GRCm39) missense probably benign
IGL02455:Dnah8 APN 17 30,891,308 (GRCm39) missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30,887,269 (GRCm39) missense probably benign
IGL02831:Dnah8 APN 17 30,931,250 (GRCm39) missense probably benign 0.23
IGL02863:Dnah8 APN 17 30,988,671 (GRCm39) missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30,940,084 (GRCm39) nonsense probably null
IGL02954:Dnah8 APN 17 30,923,809 (GRCm39) missense probably benign 0.30
IGL02964:Dnah8 APN 17 30,965,735 (GRCm39) missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30,937,980 (GRCm39) missense probably benign 0.01
IGL03081:Dnah8 APN 17 30,905,347 (GRCm39) splice site probably benign
IGL03086:Dnah8 APN 17 30,961,754 (GRCm39) missense probably damaging 1.00
IGL03087:Dnah8 APN 17 31,003,118 (GRCm39) missense probably benign
IGL03176:Dnah8 APN 17 30,913,011 (GRCm39) missense probably benign
IGL03191:Dnah8 APN 17 30,945,804 (GRCm39) missense probably damaging 0.99
IGL03210:Dnah8 APN 17 31,034,639 (GRCm39) missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30,892,894 (GRCm39) splice site probably null
IGL03255:Dnah8 APN 17 30,960,355 (GRCm39) missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30,891,323 (GRCm39) missense probably benign
IGL03348:Dnah8 APN 17 30,965,960 (GRCm39) missense probably damaging 0.99
Alternator UTSW 17 30,984,609 (GRCm39) missense probably benign
armature UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
Brush UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
Dynos UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
joule UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
solenoid UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30,854,437 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,451 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,439 (GRCm39) small deletion probably benign
I2288:Dnah8 UTSW 17 30,882,428 (GRCm39) missense probably benign
P0029:Dnah8 UTSW 17 30,984,694 (GRCm39) missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30,927,419 (GRCm39) missense probably benign 0.04
R0016:Dnah8 UTSW 17 30,882,290 (GRCm39) missense probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30,974,093 (GRCm39) missense probably damaging 1.00
R0090:Dnah8 UTSW 17 31,003,064 (GRCm39) missense probably benign 0.20
R0119:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0184:Dnah8 UTSW 17 30,902,657 (GRCm39) missense probably benign 0.04
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30,909,245 (GRCm39) missense probably benign
R0268:Dnah8 UTSW 17 30,988,681 (GRCm39) missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30,955,130 (GRCm39) missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 31,090,325 (GRCm39) missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
R0423:Dnah8 UTSW 17 30,920,955 (GRCm39) missense probably benign
R0470:Dnah8 UTSW 17 30,927,514 (GRCm39) splice site probably benign
R0477:Dnah8 UTSW 17 30,974,054 (GRCm39) missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R0499:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30,937,935 (GRCm39) missense probably benign 0.01
R0601:Dnah8 UTSW 17 30,927,332 (GRCm39) missense probably benign 0.06
R0646:Dnah8 UTSW 17 30,903,147 (GRCm39) missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30,955,129 (GRCm39) missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30,923,636 (GRCm39) missense probably benign
R0843:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R0940:Dnah8 UTSW 17 31,022,217 (GRCm39) missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30,892,894 (GRCm39) splice site probably null
R1102:Dnah8 UTSW 17 31,073,738 (GRCm39) splice site probably null
R1137:Dnah8 UTSW 17 31,074,910 (GRCm39) missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30,939,974 (GRCm39) missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30,956,269 (GRCm39) missense probably damaging 1.00
R1377:Dnah8 UTSW 17 31,059,596 (GRCm39) nonsense probably null
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1497:Dnah8 UTSW 17 30,971,049 (GRCm39) missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30,892,862 (GRCm39) missense probably benign
R1541:Dnah8 UTSW 17 30,966,221 (GRCm39) missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30,854,638 (GRCm39) missense probably benign 0.07
R1634:Dnah8 UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
R1670:Dnah8 UTSW 17 30,944,098 (GRCm39) missense probably damaging 1.00
R1710:Dnah8 UTSW 17 31,073,914 (GRCm39) missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30,988,625 (GRCm39) missense probably benign 0.28
R1761:Dnah8 UTSW 17 30,998,890 (GRCm39) missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30,941,911 (GRCm39) missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30,927,381 (GRCm39) missense probably benign 0.00
R1808:Dnah8 UTSW 17 30,903,160 (GRCm39) missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30,950,154 (GRCm39) missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30,854,479 (GRCm39) missense unknown
R1935:Dnah8 UTSW 17 30,945,870 (GRCm39) splice site probably benign
R1940:Dnah8 UTSW 17 30,950,181 (GRCm39) missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30,931,359 (GRCm39) missense probably benign 0.00
R2025:Dnah8 UTSW 17 30,950,133 (GRCm39) missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30,977,255 (GRCm39) missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30,854,632 (GRCm39) missense probably benign 0.01
R2148:Dnah8 UTSW 17 30,956,232 (GRCm39) missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30,872,367 (GRCm39) missense probably benign
R2180:Dnah8 UTSW 17 31,059,621 (GRCm39) missense probably benign 0.00
R2262:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2328:Dnah8 UTSW 17 31,013,718 (GRCm39) missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30,990,846 (GRCm39) missense probably benign
R2357:Dnah8 UTSW 17 31,093,909 (GRCm39) missense probably benign 0.00
R2360:Dnah8 UTSW 17 30,896,178 (GRCm39) missense probably benign 0.22
R2496:Dnah8 UTSW 17 31,070,705 (GRCm39) missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30,960,339 (GRCm39) nonsense probably null
R2509:Dnah8 UTSW 17 30,994,019 (GRCm39) missense probably benign 0.02
R3114:Dnah8 UTSW 17 31,052,542 (GRCm39) missense probably benign 0.04
R3708:Dnah8 UTSW 17 30,958,631 (GRCm39) missense probably damaging 0.98
R3720:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3722:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30,958,622 (GRCm39) nonsense probably null
R3747:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3748:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3749:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3787:Dnah8 UTSW 17 30,974,015 (GRCm39) missense probably damaging 1.00
R3790:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30,889,621 (GRCm39) missense probably benign 0.00
R3857:Dnah8 UTSW 17 30,882,396 (GRCm39) missense probably damaging 0.96
R3898:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3899:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3938:Dnah8 UTSW 17 31,073,911 (GRCm39) missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30,913,039 (GRCm39) splice site probably benign
R4091:Dnah8 UTSW 17 30,988,813 (GRCm39) missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30,967,533 (GRCm39) missense probably benign
R4326:Dnah8 UTSW 17 30,971,066 (GRCm39) missense probably benign 0.04
R4346:Dnah8 UTSW 17 30,944,072 (GRCm39) missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30,971,120 (GRCm39) missense probably damaging 1.00
R4457:Dnah8 UTSW 17 31,032,125 (GRCm39) missense probably benign
R4475:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4565:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4566:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4568:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4573:Dnah8 UTSW 17 30,919,380 (GRCm39) missense probably benign 0.00
R4580:Dnah8 UTSW 17 30,881,026 (GRCm39) missense probably benign 0.00
R4585:Dnah8 UTSW 17 30,970,541 (GRCm39) missense probably benign 0.01
R4611:Dnah8 UTSW 17 30,903,211 (GRCm39) missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30,902,608 (GRCm39) missense probably benign 0.08
R4721:Dnah8 UTSW 17 30,944,140 (GRCm39) missense probably damaging 1.00
R4727:Dnah8 UTSW 17 31,070,721 (GRCm39) missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4732:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4733:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4798:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4814:Dnah8 UTSW 17 30,986,898 (GRCm39) missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4894:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4900:Dnah8 UTSW 17 30,965,949 (GRCm39) missense probably damaging 1.00
R4901:Dnah8 UTSW 17 31,059,688 (GRCm39) critical splice donor site probably null
R4913:Dnah8 UTSW 17 31,038,113 (GRCm39) missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4932:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4933:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4942:Dnah8 UTSW 17 30,948,116 (GRCm39) missense probably benign
R4969:Dnah8 UTSW 17 30,941,988 (GRCm39) missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4977:Dnah8 UTSW 17 30,882,275 (GRCm39) missense probably benign 0.00
R5001:Dnah8 UTSW 17 31,006,159 (GRCm39) missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5013:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5014:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5024:Dnah8 UTSW 17 30,955,070 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5075:Dnah8 UTSW 17 31,019,505 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,958,731 (GRCm39) critical splice donor site probably null
R5112:Dnah8 UTSW 17 30,950,012 (GRCm39) missense probably benign 0.02
R5121:Dnah8 UTSW 17 31,029,327 (GRCm39) missense probably benign 0.14
R5138:Dnah8 UTSW 17 30,984,571 (GRCm39) missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30,931,269 (GRCm39) missense probably benign 0.06
R5191:Dnah8 UTSW 17 30,965,739 (GRCm39) missense probably damaging 1.00
R5238:Dnah8 UTSW 17 31,009,891 (GRCm39) missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R5358:Dnah8 UTSW 17 30,965,928 (GRCm39) missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5404:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5482:Dnah8 UTSW 17 31,019,521 (GRCm39) missense probably damaging 0.96
R5489:Dnah8 UTSW 17 31,009,930 (GRCm39) missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30,971,890 (GRCm39) missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30,925,360 (GRCm39) missense probably benign 0.00
R5640:Dnah8 UTSW 17 31,022,082 (GRCm39) missense probably damaging 1.00
R5649:Dnah8 UTSW 17 31,019,561 (GRCm39) missense probably benign 0.13
R5662:Dnah8 UTSW 17 30,956,307 (GRCm39) missense probably damaging 1.00
R5673:Dnah8 UTSW 17 31,022,235 (GRCm39) missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5699:Dnah8 UTSW 17 31,029,298 (GRCm39) missense probably benign 0.22
R5737:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5738:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5739:Dnah8 UTSW 17 30,937,981 (GRCm39) missense probably benign 0.00
R5766:Dnah8 UTSW 17 30,909,235 (GRCm39) missense probably benign 0.01
R5790:Dnah8 UTSW 17 31,093,978 (GRCm39) missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30,947,165 (GRCm39) missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 31,013,737 (GRCm39) missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5886:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5887:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30,875,659 (GRCm39) missense probably benign 0.32
R5979:Dnah8 UTSW 17 31,034,638 (GRCm39) nonsense probably null
R5986:Dnah8 UTSW 17 31,070,604 (GRCm39) missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30,882,279 (GRCm39) missense probably benign 0.32
R6042:Dnah8 UTSW 17 30,966,239 (GRCm39) missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6181:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6237:Dnah8 UTSW 17 30,966,828 (GRCm39) nonsense probably null
R6239:Dnah8 UTSW 17 31,029,333 (GRCm39) missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6365:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6416:Dnah8 UTSW 17 30,984,609 (GRCm39) missense probably benign
R6443:Dnah8 UTSW 17 30,990,859 (GRCm39) missense probably benign 0.10
R6478:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6479:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6480:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6481:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6533:Dnah8 UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6608:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6610:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6675:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6723:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6724:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6754:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6755:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6759:Dnah8 UTSW 17 30,882,266 (GRCm39) splice site probably null
R6765:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6766:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6778:Dnah8 UTSW 17 30,854,640 (GRCm39) missense probably benign 0.00
R6781:Dnah8 UTSW 17 30,984,698 (GRCm39) frame shift probably null
R6788:Dnah8 UTSW 17 30,867,439 (GRCm39) missense probably benign 0.14
R6814:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30,960,147 (GRCm39) missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30,929,525 (GRCm39) missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30,965,933 (GRCm39) missense probably damaging 1.00
R6944:Dnah8 UTSW 17 31,013,633 (GRCm39) missense probably benign 0.09
R6982:Dnah8 UTSW 17 30,986,899 (GRCm39) missense probably benign 0.03
R6984:Dnah8 UTSW 17 30,958,712 (GRCm39) missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30,881,065 (GRCm39) missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30,862,249 (GRCm39) missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30,923,698 (GRCm39) missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
R7112:Dnah8 UTSW 17 31,090,366 (GRCm39) missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30,988,618 (GRCm39) missense possibly damaging 0.90
R7146:Dnah8 UTSW 17 30,863,591 (GRCm39) missense probably benign 0.01
R7309:Dnah8 UTSW 17 31,093,988 (GRCm39) missense probably damaging 1.00
R7324:Dnah8 UTSW 17 31,003,099 (GRCm39) missense probably benign 0.01
R7373:Dnah8 UTSW 17 30,986,939 (GRCm39) critical splice donor site probably null
R7423:Dnah8 UTSW 17 30,923,743 (GRCm39) missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30,925,363 (GRCm39) missense probably damaging 0.98
R7450:Dnah8 UTSW 17 31,006,165 (GRCm39) missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30,994,077 (GRCm39) missense probably damaging 0.98
R7604:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R7635:Dnah8 UTSW 17 31,004,081 (GRCm39) missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30,868,651 (GRCm39) missense probably benign 0.00
R7793:Dnah8 UTSW 17 31,074,918 (GRCm39) missense probably benign 0.20
R7827:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R7866:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30,882,348 (GRCm39) missense probably benign
R7891:Dnah8 UTSW 17 30,931,263 (GRCm39) missense probably benign 0.09
R7977:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30,960,311 (GRCm39) nonsense probably null
R8076:Dnah8 UTSW 17 31,003,127 (GRCm39) missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30,892,797 (GRCm39) missense probably damaging 1.00
R8199:Dnah8 UTSW 17 31,090,393 (GRCm39) missense probably benign 0.06
R8253:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8270:Dnah8 UTSW 17 31,059,687 (GRCm39) missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30,984,701 (GRCm39) missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30,988,805 (GRCm39) missense probably benign 0.12
R8348:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8348:Dnah8 UTSW 17 30,955,121 (GRCm39) missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30,862,234 (GRCm39) missense probably benign 0.17
R8355:Dnah8 UTSW 17 30,914,152 (GRCm39) missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8448:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8459:Dnah8 UTSW 17 30,944,221 (GRCm39) critical splice donor site probably null
R8462:Dnah8 UTSW 17 30,875,603 (GRCm39) missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30,940,108 (GRCm39) missense probably benign
R8524:Dnah8 UTSW 17 30,934,472 (GRCm39) missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30,940,084 (GRCm39) nonsense probably null
R8698:Dnah8 UTSW 17 31,094,009 (GRCm39) missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30,960,289 (GRCm39) missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8781:Dnah8 UTSW 17 30,944,078 (GRCm39) missense probably damaging 1.00
R8821:Dnah8 UTSW 17 31,013,712 (GRCm39) missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30,981,616 (GRCm39) missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30,927,286 (GRCm39) missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 31,070,628 (GRCm39) missense probably damaging 0.98
R8994:Dnah8 UTSW 17 31,009,807 (GRCm39) missense probably benign 0.05
R9031:Dnah8 UTSW 17 30,956,401 (GRCm39) missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30,975,729 (GRCm39) missense possibly damaging 0.63
R9225:Dnah8 UTSW 17 30,854,647 (GRCm39) missense probably benign 0.01
R9280:Dnah8 UTSW 17 31,004,071 (GRCm39) missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30,944,099 (GRCm39) missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30,990,857 (GRCm39) missense probably benign
R9347:Dnah8 UTSW 17 30,927,333 (GRCm39) missense probably benign 0.00
R9393:Dnah8 UTSW 17 30,872,361 (GRCm39) missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 31,029,297 (GRCm39) missense probably benign 0.02
R9458:Dnah8 UTSW 17 31,049,777 (GRCm39) missense probably damaging 1.00
R9465:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9518:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9524:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9564:Dnah8 UTSW 17 30,932,021 (GRCm39) missense probably benign 0.07
R9587:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9599:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9641:Dnah8 UTSW 17 30,932,029 (GRCm39) missense probably benign 0.13
R9674:Dnah8 UTSW 17 30,998,112 (GRCm39) missense possibly damaging 0.84
R9679:Dnah8 UTSW 17 31,037,115 (GRCm39) missense probably benign
R9789:Dnah8 UTSW 17 30,980,104 (GRCm39) critical splice donor site probably null
RF027:Dnah8 UTSW 17 30,854,450 (GRCm39) frame shift probably null
X0001:Dnah8 UTSW 17 30,967,654 (GRCm39) missense probably damaging 1.00
X0013:Dnah8 UTSW 17 31,038,160 (GRCm39) missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30,867,514 (GRCm39) missense probably benign
Z1177:Dnah8 UTSW 17 30,932,069 (GRCm39) missense probably null 1.00
Z1177:Dnah8 UTSW 17 30,913,007 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTGGGAGTCATGACCCC -3'
(R):5'- AGGGAGCACGGTTTCATGAATG -3'

Sequencing Primer
(F):5'- CCCCAGGGACAGTGACATAATTG -3'
(R):5'- CACGGTTTCATGAATGAACAAAG -3'
Posted On 2019-11-12