Incidental Mutation 'R7686:Smg1'
ID 593093
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms 5430435M13Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik, C130002K18Rik
MMRRC Submission 045751-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7686 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 117730531-117842893 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117767081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1804 (Y1804N)
Ref Sequence ENSEMBL: ENSMUSP00000032891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: Y1804N
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: Y1804N

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl A T 1: 66,887,557 (GRCm39) probably null Het
Adgrg5 A T 8: 95,664,430 (GRCm39) I347F Het
Agmo T C 12: 37,469,973 (GRCm39) V431A probably benign Het
Arl14epl A G 18: 47,065,523 (GRCm39) D96G probably damaging Het
Asxl1 C T 2: 153,233,534 (GRCm39) S113F probably damaging Het
Axdnd1 A T 1: 156,223,034 (GRCm39) C81* probably null Het
Bloc1s3 C T 7: 19,241,531 (GRCm39) probably benign Het
Bmper C G 9: 23,310,840 (GRCm39) L425V probably benign Het
Bok A T 1: 93,622,822 (GRCm39) T194S probably benign Het
Bpifa5 A T 2: 154,007,432 (GRCm39) I125L probably benign Het
Brcc3dc T C 10: 108,535,301 (GRCm39) E218G probably damaging Het
Brd10 A T 19: 29,694,870 (GRCm39) I1541N probably benign Het
Brpf3 T C 17: 29,025,908 (GRCm39) I327T probably damaging Het
Camk1 T A 6: 113,313,158 (GRCm39) N297Y probably damaging Het
Catsper2 C T 2: 121,227,937 (GRCm39) probably null Het
Ccdc171 A T 4: 83,575,556 (GRCm39) N480I unknown Het
Cd83 A G 13: 43,938,848 (GRCm39) M22V probably benign Het
Col1a2 A G 6: 4,518,964 (GRCm39) D243G unknown Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Ctla4 A T 1: 60,951,752 (GRCm39) T94S probably benign Het
Cyp2b19 T C 7: 26,461,768 (GRCm39) F196S probably damaging Het
Dhx32 A T 7: 133,361,430 (GRCm39) M1K probably null Het
Epha3 T A 16: 63,593,651 (GRCm39) I146F probably damaging Het
Erbb2 T A 11: 98,326,399 (GRCm39) S1008T probably benign Het
Esp34 A G 17: 38,870,534 (GRCm39) R143G possibly damaging Het
Fam135b T C 15: 71,335,233 (GRCm39) K654E possibly damaging Het
Fgr T C 4: 132,725,324 (GRCm39) M343T probably benign Het
Fibcd1 T G 2: 31,723,880 (GRCm39) D253A probably damaging Het
Foxk1 C T 5: 142,387,625 (GRCm39) S116L probably damaging Het
Gimap8 G A 6: 48,633,006 (GRCm39) G275E probably damaging Het
Glp1r T C 17: 31,144,633 (GRCm39) Y269H probably damaging Het
H2ac20 T C 3: 96,127,886 (GRCm39) E92G probably damaging Het
Lbr A G 1: 181,645,086 (GRCm39) F522S probably damaging Het
Lca5 T C 9: 83,277,292 (GRCm39) N684S probably benign Het
Leng8 C A 7: 4,146,504 (GRCm39) S372* probably null Het
Lrp2 A G 2: 69,319,581 (GRCm39) Y1981H probably damaging Het
Lrrc37a T G 11: 103,389,062 (GRCm39) Q2121P unknown Het
Lrrn2 A G 1: 132,866,332 (GRCm39) T466A probably benign Het
Map3k19 A T 1: 127,749,985 (GRCm39) L1122* probably null Het
Mfsd6 T C 1: 52,701,554 (GRCm39) E632G probably benign Het
Mfsd6l C T 11: 68,448,052 (GRCm39) A301V probably benign Het
Mro A T 18: 74,010,510 (GRCm39) M197L probably benign Het
Ncam2 A T 16: 81,418,342 (GRCm39) E799V probably damaging Het
Nek9 A T 12: 85,350,433 (GRCm39) D880E probably benign Het
Ntng1 T A 3: 109,842,330 (GRCm39) I148L possibly damaging Het
Or1ad6 A G 11: 50,860,582 (GRCm39) T246A possibly damaging Het
Or5ac23 T A 16: 59,149,379 (GRCm39) R164S probably damaging Het
P2ry13 C T 3: 59,117,439 (GRCm39) G113D probably damaging Het
Pnpt1 A T 11: 29,107,070 (GRCm39) T687S probably damaging Het
Pou2af1 T C 9: 51,149,486 (GRCm39) Y193H probably damaging Het
Ppp1r14c T A 10: 3,413,396 (GRCm39) I143N probably damaging Het
Ppp1r16a A T 15: 76,578,783 (GRCm39) S496C probably benign Het
Prdm12 G A 2: 31,530,229 (GRCm39) R40Q probably damaging Het
Rabepk C T 2: 34,669,308 (GRCm39) G362S probably damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rnf26rt A T 6: 76,474,013 (GRCm39) L201H probably damaging Het
Robo2 C A 16: 73,755,293 (GRCm39) V743F probably damaging Het
Scart1 T A 7: 139,802,116 (GRCm39) C148* probably null Het
Scart2 A G 7: 139,828,965 (GRCm39) N208S probably benign Het
Ssh2 A G 11: 77,316,150 (GRCm39) E257G possibly damaging Het
Stoml3 T C 3: 53,410,589 (GRCm39) I101T probably damaging Het
Stxbp5 T C 10: 9,645,154 (GRCm39) D950G probably damaging Het
Syt10 T C 15: 89,698,360 (GRCm39) D328G probably damaging Het
Taf3 T C 2: 9,956,299 (GRCm39) K623E probably damaging Het
Tas2r134 T A 2: 51,518,255 (GRCm39) S245T possibly damaging Het
Tfap2b G C 1: 19,284,511 (GRCm39) D140H probably damaging Het
Tjp3 C T 10: 81,113,885 (GRCm39) V458I probably benign Het
Tnpo3 G T 6: 29,562,899 (GRCm39) S606* probably null Het
Tram1l1 T C 3: 124,114,959 (GRCm39) F40L probably benign Het
Ttc29 A T 8: 79,119,759 (GRCm39) T464S probably benign Het
Txndc9 A T 1: 38,026,849 (GRCm39) M192K probably benign Het
Urb2 C A 8: 124,771,911 (GRCm39) A1444E probably benign Het
Uty G A Y: 1,158,075 (GRCm39) T657I possibly damaging Het
Vmn1r1 A T 1: 181,985,590 (GRCm39) V25D probably damaging Het
Vmn2r65 A T 7: 84,589,744 (GRCm39) I724N probably damaging Het
Xkr6 C T 14: 63,844,295 (GRCm39) T106M possibly damaging Het
Zc3h18 G A 8: 123,140,615 (GRCm39) R850Q unknown Het
Zfp341 A G 2: 154,466,781 (GRCm39) E50G probably damaging Het
Zfp62 C A 11: 49,107,985 (GRCm39) A692E probably damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 117,797,494 (GRCm39) utr 3 prime probably benign
IGL00481:Smg1 APN 7 117,810,017 (GRCm39) missense possibly damaging 0.67
IGL00503:Smg1 APN 7 117,784,706 (GRCm39) utr 3 prime probably benign
IGL00927:Smg1 APN 7 117,739,855 (GRCm39) missense probably damaging 1.00
IGL01333:Smg1 APN 7 117,762,601 (GRCm39) splice site probably benign
IGL01344:Smg1 APN 7 117,790,059 (GRCm39) utr 3 prime probably benign
IGL01397:Smg1 APN 7 117,762,444 (GRCm39) utr 3 prime probably benign
IGL01403:Smg1 APN 7 117,757,355 (GRCm39) utr 3 prime probably benign
IGL01573:Smg1 APN 7 117,767,185 (GRCm39) utr 3 prime probably benign
IGL01872:Smg1 APN 7 117,748,167 (GRCm39) utr 3 prime probably benign
IGL02010:Smg1 APN 7 117,785,369 (GRCm39) utr 3 prime probably benign
IGL02158:Smg1 APN 7 117,812,169 (GRCm39) missense possibly damaging 0.77
IGL02268:Smg1 APN 7 117,781,764 (GRCm39) missense probably benign 0.19
IGL02314:Smg1 APN 7 117,753,932 (GRCm39) utr 3 prime probably benign
IGL02552:Smg1 APN 7 117,795,117 (GRCm39) utr 3 prime probably benign
IGL02577:Smg1 APN 7 117,802,345 (GRCm39) missense probably damaging 0.99
IGL02859:Smg1 APN 7 117,748,156 (GRCm39) utr 3 prime probably benign
IGL02890:Smg1 APN 7 117,784,724 (GRCm39) utr 3 prime probably benign
IGL02892:Smg1 APN 7 117,767,178 (GRCm39) utr 3 prime probably benign
IGL03119:Smg1 APN 7 117,794,336 (GRCm39) utr 3 prime probably benign
IGL03123:Smg1 APN 7 117,756,404 (GRCm39) utr 3 prime probably benign
IGL03128:Smg1 APN 7 117,802,282 (GRCm39) missense probably benign 0.03
IGL03184:Smg1 APN 7 117,779,603 (GRCm39) missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 117,784,764 (GRCm39) missense unknown
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0098:Smg1 UTSW 7 117,744,690 (GRCm39) missense probably benign 0.02
R0139:Smg1 UTSW 7 117,751,898 (GRCm39) critical splice donor site probably null
R0371:Smg1 UTSW 7 117,767,523 (GRCm39) utr 3 prime probably benign
R0415:Smg1 UTSW 7 117,781,691 (GRCm39) missense probably benign 0.34
R0416:Smg1 UTSW 7 117,783,684 (GRCm39) splice site probably benign
R0423:Smg1 UTSW 7 117,776,103 (GRCm39) missense possibly damaging 0.53
R0600:Smg1 UTSW 7 117,759,606 (GRCm39) utr 3 prime probably benign
R0626:Smg1 UTSW 7 117,781,606 (GRCm39) missense possibly damaging 0.82
R0627:Smg1 UTSW 7 117,767,084 (GRCm39) utr 3 prime probably benign
R0727:Smg1 UTSW 7 117,765,645 (GRCm39) utr 3 prime probably benign
R0729:Smg1 UTSW 7 117,745,512 (GRCm39) utr 3 prime probably benign
R0841:Smg1 UTSW 7 117,742,524 (GRCm39) missense possibly damaging 0.96
R1114:Smg1 UTSW 7 117,759,013 (GRCm39) utr 3 prime probably benign
R1256:Smg1 UTSW 7 117,802,310 (GRCm39) missense probably damaging 1.00
R1298:Smg1 UTSW 7 117,767,434 (GRCm39) utr 3 prime probably benign
R1370:Smg1 UTSW 7 117,758,975 (GRCm39) utr 3 prime probably benign
R1591:Smg1 UTSW 7 117,756,142 (GRCm39) utr 3 prime probably benign
R1736:Smg1 UTSW 7 117,765,190 (GRCm39) splice site probably null
R1755:Smg1 UTSW 7 117,802,287 (GRCm39) nonsense probably null
R1765:Smg1 UTSW 7 117,738,938 (GRCm39) missense probably benign 0.03
R1789:Smg1 UTSW 7 117,745,021 (GRCm39) missense possibly damaging 0.73
R1845:Smg1 UTSW 7 117,753,845 (GRCm39) utr 3 prime probably benign
R1908:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1909:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1942:Smg1 UTSW 7 117,757,326 (GRCm39) utr 3 prime probably benign
R2064:Smg1 UTSW 7 117,756,090 (GRCm39) utr 3 prime probably benign
R2072:Smg1 UTSW 7 117,762,389 (GRCm39) utr 3 prime probably benign
R2154:Smg1 UTSW 7 117,757,299 (GRCm39) utr 3 prime probably benign
R2895:Smg1 UTSW 7 117,788,366 (GRCm39) utr 3 prime probably benign
R2915:Smg1 UTSW 7 117,810,102 (GRCm39) splice site probably benign
R3416:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3417:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3873:Smg1 UTSW 7 117,753,885 (GRCm39) utr 3 prime probably benign
R4082:Smg1 UTSW 7 117,759,469 (GRCm39) utr 3 prime probably benign
R4230:Smg1 UTSW 7 117,747,956 (GRCm39) critical splice donor site probably null
R4304:Smg1 UTSW 7 117,738,741 (GRCm39) missense probably benign 0.03
R4549:Smg1 UTSW 7 117,758,906 (GRCm39) utr 3 prime probably benign
R4571:Smg1 UTSW 7 117,738,688 (GRCm39) missense possibly damaging 0.72
R4638:Smg1 UTSW 7 117,795,149 (GRCm39) utr 3 prime probably benign
R4642:Smg1 UTSW 7 117,753,487 (GRCm39) utr 3 prime probably benign
R4656:Smg1 UTSW 7 117,812,174 (GRCm39) missense probably benign 0.00
R4754:Smg1 UTSW 7 117,755,954 (GRCm39) utr 3 prime probably benign
R4798:Smg1 UTSW 7 117,779,697 (GRCm39) missense probably benign 0.32
R4906:Smg1 UTSW 7 117,751,631 (GRCm39) utr 3 prime probably benign
R4978:Smg1 UTSW 7 117,753,470 (GRCm39) utr 3 prime probably benign
R4989:Smg1 UTSW 7 117,807,274 (GRCm39) missense probably benign
R4989:Smg1 UTSW 7 117,757,323 (GRCm39) utr 3 prime probably benign
R5026:Smg1 UTSW 7 117,792,768 (GRCm39) utr 3 prime probably benign
R5124:Smg1 UTSW 7 117,812,235 (GRCm39) missense probably benign 0.00
R5318:Smg1 UTSW 7 117,759,427 (GRCm39) utr 3 prime probably benign
R5356:Smg1 UTSW 7 117,794,356 (GRCm39) utr 3 prime probably benign
R5404:Smg1 UTSW 7 117,806,131 (GRCm39) missense probably damaging 1.00
R5423:Smg1 UTSW 7 117,745,294 (GRCm39) missense possibly damaging 0.70
R5441:Smg1 UTSW 7 117,794,304 (GRCm39) utr 3 prime probably benign
R5490:Smg1 UTSW 7 117,738,659 (GRCm39) missense possibly damaging 0.86
R5541:Smg1 UTSW 7 117,756,386 (GRCm39) utr 3 prime probably benign
R5564:Smg1 UTSW 7 117,789,042 (GRCm39) utr 3 prime probably benign
R5580:Smg1 UTSW 7 117,748,125 (GRCm39) utr 3 prime probably benign
R5600:Smg1 UTSW 7 117,767,107 (GRCm39) utr 3 prime probably benign
R5628:Smg1 UTSW 7 117,753,924 (GRCm39) utr 3 prime probably benign
R5646:Smg1 UTSW 7 117,811,782 (GRCm39) missense probably benign 0.42
R5656:Smg1 UTSW 7 117,753,887 (GRCm39) utr 3 prime probably benign
R5660:Smg1 UTSW 7 117,742,570 (GRCm39) missense probably benign 0.33
R5706:Smg1 UTSW 7 117,744,813 (GRCm39) missense possibly damaging 0.86
R5786:Smg1 UTSW 7 117,812,120 (GRCm39) missense probably benign 0.12
R5890:Smg1 UTSW 7 117,789,809 (GRCm39) utr 3 prime probably benign
R5912:Smg1 UTSW 7 117,753,809 (GRCm39) utr 3 prime probably benign
R5977:Smg1 UTSW 7 117,740,580 (GRCm39) utr 3 prime probably benign
R5993:Smg1 UTSW 7 117,739,732 (GRCm39) missense probably benign 0.33
R6161:Smg1 UTSW 7 117,762,553 (GRCm39) utr 3 prime probably benign
R6187:Smg1 UTSW 7 117,788,386 (GRCm39) utr 3 prime probably benign
R6264:Smg1 UTSW 7 117,765,310 (GRCm39) utr 3 prime probably benign
R6331:Smg1 UTSW 7 117,753,500 (GRCm39) utr 3 prime probably benign
R6561:Smg1 UTSW 7 117,765,300 (GRCm39) utr 3 prime probably benign
R6571:Smg1 UTSW 7 117,783,737 (GRCm39) utr 3 prime probably benign
R6736:Smg1 UTSW 7 117,756,389 (GRCm39) utr 3 prime probably benign
R6752:Smg1 UTSW 7 117,762,539 (GRCm39) utr 3 prime probably benign
R6777:Smg1 UTSW 7 117,788,340 (GRCm39) utr 3 prime probably benign
R6788:Smg1 UTSW 7 117,783,794 (GRCm39) utr 3 prime probably benign
R6883:Smg1 UTSW 7 117,767,403 (GRCm39) utr 3 prime probably benign
R6991:Smg1 UTSW 7 117,767,091 (GRCm39) utr 3 prime probably benign
R7056:Smg1 UTSW 7 117,745,623 (GRCm39) splice site probably benign
R7058:Smg1 UTSW 7 117,797,502 (GRCm39) utr 3 prime probably benign
R7100:Smg1 UTSW 7 117,783,743 (GRCm39) missense unknown
R7133:Smg1 UTSW 7 117,752,131 (GRCm39) missense unknown
R7221:Smg1 UTSW 7 117,782,020 (GRCm39) missense possibly damaging 0.86
R7229:Smg1 UTSW 7 117,776,178 (GRCm39) missense probably benign 0.03
R7293:Smg1 UTSW 7 117,765,322 (GRCm39) missense unknown
R7361:Smg1 UTSW 7 117,784,200 (GRCm39) missense unknown
R7438:Smg1 UTSW 7 117,795,116 (GRCm39) missense unknown
R7798:Smg1 UTSW 7 117,771,162 (GRCm39) missense possibly damaging 0.73
R7908:Smg1 UTSW 7 117,785,357 (GRCm39) missense unknown
R7923:Smg1 UTSW 7 117,742,545 (GRCm39) missense possibly damaging 0.96
R7978:Smg1 UTSW 7 117,792,878 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,365 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,364 (GRCm39) missense unknown
R8025:Smg1 UTSW 7 117,806,212 (GRCm39) nonsense probably null
R8056:Smg1 UTSW 7 117,759,589 (GRCm39) missense unknown
R8061:Smg1 UTSW 7 117,751,610 (GRCm39) missense unknown
R8095:Smg1 UTSW 7 117,772,285 (GRCm39) missense unknown
R8198:Smg1 UTSW 7 117,744,829 (GRCm39) missense probably benign 0.03
R8399:Smg1 UTSW 7 117,789,794 (GRCm39) missense unknown
R8445:Smg1 UTSW 7 117,736,200 (GRCm39) missense possibly damaging 0.72
R8519:Smg1 UTSW 7 117,770,982 (GRCm39) utr 3 prime probably benign
R8817:Smg1 UTSW 7 117,758,887 (GRCm39) missense unknown
R8832:Smg1 UTSW 7 117,739,006 (GRCm39) missense probably benign 0.33
R8855:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8866:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8946:Smg1 UTSW 7 117,751,900 (GRCm39) missense probably null
R8954:Smg1 UTSW 7 117,806,215 (GRCm39) missense probably damaging 1.00
R8967:Smg1 UTSW 7 117,765,739 (GRCm39) missense unknown
R9072:Smg1 UTSW 7 117,783,032 (GRCm39) missense unknown
R9090:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9156:Smg1 UTSW 7 117,753,884 (GRCm39) missense unknown
R9198:Smg1 UTSW 7 117,795,179 (GRCm39) missense unknown
R9240:Smg1 UTSW 7 117,739,031 (GRCm39) missense probably benign 0.18
R9271:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9289:Smg1 UTSW 7 117,744,639 (GRCm39) missense possibly damaging 0.53
R9378:Smg1 UTSW 7 117,777,998 (GRCm39) nonsense probably null
R9396:Smg1 UTSW 7 117,807,303 (GRCm39) missense unknown
R9469:Smg1 UTSW 7 117,739,774 (GRCm39) missense possibly damaging 0.72
R9539:Smg1 UTSW 7 117,744,976 (GRCm39) missense probably benign 0.03
R9549:Smg1 UTSW 7 117,795,254 (GRCm39) missense unknown
R9563:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9564:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9597:Smg1 UTSW 7 117,812,270 (GRCm39) missense unknown
R9643:Smg1 UTSW 7 117,755,933 (GRCm39) missense unknown
R9703:Smg1 UTSW 7 117,739,744 (GRCm39) missense possibly damaging 0.73
R9730:Smg1 UTSW 7 117,783,004 (GRCm39) missense unknown
Z1088:Smg1 UTSW 7 117,777,622 (GRCm39) missense possibly damaging 0.96
Z1088:Smg1 UTSW 7 117,767,884 (GRCm39) nonsense probably null
Z1088:Smg1 UTSW 7 117,753,858 (GRCm39) utr 3 prime probably benign
Z1176:Smg1 UTSW 7 117,806,130 (GRCm39) missense unknown
Z1176:Smg1 UTSW 7 117,806,110 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,812,256 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,767,831 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- ACACCAAACTGTTCTGGTTGTTC -3'
(R):5'- GGCACCGTCTTCTAAGGGAATTC -3'

Sequencing Primer
(F):5'- CAAACTGTTCTGGTTGTTCTATGAAG -3'
(R):5'- CACCGTCTTCTAAGGGAATTCATTTG -3'
Posted On 2019-11-12