Incidental Mutation 'R7686:5830411N06Rik'
ID 593096
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7686 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140249052 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 208 (N208S)
Ref Sequence ENSEMBL: ENSMUSP00000131905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect probably benign
Transcript: ENSMUST00000093984
AA Change: N208S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: N208S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164583
AA Change: N208S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: N208S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,470 I1541N probably benign Het
Acadl A T 1: 66,848,398 probably null Het
Adgrg5 A T 8: 94,937,802 I347F Het
Agmo T C 12: 37,419,974 V431A probably benign Het
Arl14epl A G 18: 46,932,456 D96G probably damaging Het
Asxl1 C T 2: 153,391,614 S113F probably damaging Het
Axdnd1 A T 1: 156,395,464 C81* probably null Het
Bloc1s3 C T 7: 19,507,606 probably benign Het
Bmper C G 9: 23,399,544 L425V probably benign Het
Bok A T 1: 93,695,100 T194S probably benign Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Brpf3 T C 17: 28,806,934 I327T probably damaging Het
Camk1 T A 6: 113,336,197 N297Y probably damaging Het
Catsper2 C T 2: 121,397,456 probably null Het
Ccdc171 A T 4: 83,657,319 N480I unknown Het
Cd163l1 T A 7: 140,222,203 C148* probably null Het
Cd83 A G 13: 43,785,372 M22V probably benign Het
Col1a2 A G 6: 4,518,964 D243G unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Ctla4 A T 1: 60,912,593 T94S probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Dhx32 A T 7: 133,759,701 M1K probably null Het
Epha3 T A 16: 63,773,288 I146F probably damaging Het
Erbb2 T A 11: 98,435,573 S1008T probably benign Het
Esp34 A G 17: 38,559,643 R143G possibly damaging Het
Fam135b T C 15: 71,463,384 K654E possibly damaging Het
Fgr T C 4: 132,998,013 M343T probably benign Het
Fibcd1 T G 2: 31,833,868 D253A probably damaging Het
Foxk1 C T 5: 142,401,870 S116L probably damaging Het
Gimap8 G A 6: 48,656,072 G275E probably damaging Het
Glp1r T C 17: 30,925,659 Y269H probably damaging Het
Gm5136 T C 10: 108,699,440 E218G probably damaging Het
Gm9008 A T 6: 76,497,030 L201H probably damaging Het
Hist2h2ac T C 3: 96,220,570 E92G probably damaging Het
Lbr A G 1: 181,817,521 F522S probably damaging Het
Lca5 T C 9: 83,395,239 N684S probably benign Het
Leng8 C A 7: 4,143,505 S372* probably null Het
Lrp2 A G 2: 69,489,237 Y1981H probably damaging Het
Lrrc37a T G 11: 103,498,236 Q2121P unknown Het
Lrrn2 A G 1: 132,938,594 T466A probably benign Het
Map3k19 A T 1: 127,822,248 L1122* probably null Het
Mfsd6 T C 1: 52,662,395 E632G probably benign Het
Mfsd6l C T 11: 68,557,226 A301V probably benign Het
Mro A T 18: 73,877,439 M197L probably benign Het
Ncam2 A T 16: 81,621,454 E799V probably damaging Het
Nek9 A T 12: 85,303,659 D880E probably benign Het
Ntng1 T A 3: 109,935,014 I148L possibly damaging Het
Olfr1378 A G 11: 50,969,755 T246A possibly damaging Het
Olfr205 T A 16: 59,329,016 R164S probably damaging Het
P2ry13 C T 3: 59,210,018 G113D probably damaging Het
Pnpt1 A T 11: 29,157,070 T687S probably damaging Het
Pou2af1 T C 9: 51,238,186 Y193H probably damaging Het
Ppp1r14c T A 10: 3,463,396 I143N probably damaging Het
Ppp1r16a A T 15: 76,694,583 S496C probably benign Het
Prdm12 G A 2: 31,640,217 R40Q probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 C A 16: 73,958,405 V743F probably damaging Het
Smg1 A T 7: 118,167,858 Y1804N unknown Het
Ssh2 A G 11: 77,425,324 E257G possibly damaging Het
Stoml3 T C 3: 53,503,168 I101T probably damaging Het
Stxbp5 T C 10: 9,769,410 D950G probably damaging Het
Syt10 T C 15: 89,814,157 D328G probably damaging Het
Taf3 T C 2: 9,951,488 K623E probably damaging Het
Tas2r134 T A 2: 51,628,243 S245T possibly damaging Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Tjp3 C T 10: 81,278,051 V458I probably benign Het
Tnpo3 G T 6: 29,562,900 S606* probably null Het
Tram1l1 T C 3: 124,321,310 F40L probably benign Het
Ttc29 A T 8: 78,393,130 T464S probably benign Het
Txndc9 A T 1: 37,987,768 M192K probably benign Het
Urb2 C A 8: 124,045,172 A1444E probably benign Het
Uty G A Y: 1,158,075 T657I possibly damaging Het
Vmn1r1 A T 1: 182,158,025 V25D probably damaging Het
Vmn2r65 A T 7: 84,940,536 I724N probably damaging Het
Xkr6 C T 14: 63,606,846 T106M possibly damaging Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp341 A G 2: 154,624,861 E50G probably damaging Het
Zfp62 C A 11: 49,217,158 A692E probably damaging Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5571:5830411N06Rik UTSW 7 140249123 missense probably damaging 1.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGTTGATGGTGGCAGTCC -3'
(R):5'- AACTATGAATCTGGGGTAAGGGTTC -3'

Sequencing Primer
(F):5'- ATGGTGGCAGTCCTTGTGC -3'
(R):5'- GGGTAAGGGTTCTATTGACACTAC -3'
Posted On 2019-11-12