Incidental Mutation 'R7686:Lrrc37a'
ID593114
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7686 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103498236 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 2121 (Q2121P)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect unknown
Transcript: ENSMUST00000153273
AA Change: Q2121P
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: Q2121P

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,249,052 N208S probably benign Het
9930021J03Rik A T 19: 29,717,470 I1541N probably benign Het
Acadl A T 1: 66,848,398 probably null Het
Adgrg5 A T 8: 94,937,802 I347F Het
Agmo T C 12: 37,419,974 V431A probably benign Het
Arl14epl A G 18: 46,932,456 D96G probably damaging Het
Asxl1 C T 2: 153,391,614 S113F probably damaging Het
Axdnd1 A T 1: 156,395,464 C81* probably null Het
Bloc1s3 C T 7: 19,507,606 probably benign Het
Bmper C G 9: 23,399,544 L425V probably benign Het
Bok A T 1: 93,695,100 T194S probably benign Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Brpf3 T C 17: 28,806,934 I327T probably damaging Het
Camk1 T A 6: 113,336,197 N297Y probably damaging Het
Catsper2 C T 2: 121,397,456 probably null Het
Ccdc171 A T 4: 83,657,319 N480I unknown Het
Cd163l1 T A 7: 140,222,203 C148* probably null Het
Cd83 A G 13: 43,785,372 M22V probably benign Het
Col1a2 A G 6: 4,518,964 D243G unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Ctla4 A T 1: 60,912,593 T94S probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Dhx32 A T 7: 133,759,701 M1K probably null Het
Epha3 T A 16: 63,773,288 I146F probably damaging Het
Erbb2 T A 11: 98,435,573 S1008T probably benign Het
Esp34 A G 17: 38,559,643 R143G possibly damaging Het
Fam135b T C 15: 71,463,384 K654E possibly damaging Het
Fgr T C 4: 132,998,013 M343T probably benign Het
Fibcd1 T G 2: 31,833,868 D253A probably damaging Het
Foxk1 C T 5: 142,401,870 S116L probably damaging Het
Gimap8 G A 6: 48,656,072 G275E probably damaging Het
Glp1r T C 17: 30,925,659 Y269H probably damaging Het
Gm5136 T C 10: 108,699,440 E218G probably damaging Het
Gm9008 A T 6: 76,497,030 L201H probably damaging Het
Hist2h2ac T C 3: 96,220,570 E92G probably damaging Het
Lbr A G 1: 181,817,521 F522S probably damaging Het
Lca5 T C 9: 83,395,239 N684S probably benign Het
Leng8 C A 7: 4,143,505 S372* probably null Het
Lrp2 A G 2: 69,489,237 Y1981H probably damaging Het
Lrrn2 A G 1: 132,938,594 T466A probably benign Het
Map3k19 A T 1: 127,822,248 L1122* probably null Het
Mfsd6 T C 1: 52,662,395 E632G probably benign Het
Mfsd6l C T 11: 68,557,226 A301V probably benign Het
Mro A T 18: 73,877,439 M197L probably benign Het
Ncam2 A T 16: 81,621,454 E799V probably damaging Het
Nek9 A T 12: 85,303,659 D880E probably benign Het
Ntng1 T A 3: 109,935,014 I148L possibly damaging Het
Olfr1378 A G 11: 50,969,755 T246A possibly damaging Het
Olfr205 T A 16: 59,329,016 R164S probably damaging Het
P2ry13 C T 3: 59,210,018 G113D probably damaging Het
Pnpt1 A T 11: 29,157,070 T687S probably damaging Het
Pou2af1 T C 9: 51,238,186 Y193H probably damaging Het
Ppp1r14c T A 10: 3,463,396 I143N probably damaging Het
Ppp1r16a A T 15: 76,694,583 S496C probably benign Het
Prdm12 G A 2: 31,640,217 R40Q probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 C A 16: 73,958,405 V743F probably damaging Het
Smg1 A T 7: 118,167,858 Y1804N unknown Het
Ssh2 A G 11: 77,425,324 E257G possibly damaging Het
Stoml3 T C 3: 53,503,168 I101T probably damaging Het
Stxbp5 T C 10: 9,769,410 D950G probably damaging Het
Syt10 T C 15: 89,814,157 D328G probably damaging Het
Taf3 T C 2: 9,951,488 K623E probably damaging Het
Tas2r134 T A 2: 51,628,243 S245T possibly damaging Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Tjp3 C T 10: 81,278,051 V458I probably benign Het
Tnpo3 G T 6: 29,562,900 S606* probably null Het
Tram1l1 T C 3: 124,321,310 F40L probably benign Het
Ttc29 A T 8: 78,393,130 T464S probably benign Het
Txndc9 A T 1: 37,987,768 M192K probably benign Het
Urb2 C A 8: 124,045,172 A1444E probably benign Het
Uty G A Y: 1,158,075 T657I possibly damaging Het
Vmn1r1 A T 1: 182,158,025 V25D probably damaging Het
Vmn2r65 A T 7: 84,940,536 I724N probably damaging Het
Xkr6 C T 14: 63,606,846 T106M possibly damaging Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp341 A G 2: 154,624,861 E50G probably damaging Het
Zfp62 C A 11: 49,217,158 A692E probably damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103499638 missense probably benign 0.26
R7694:Lrrc37a UTSW 11 103504378 missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103504300 missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103497459 missense unknown
R7841:Lrrc37a UTSW 11 103501105 missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103503042 missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103501481 missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103457961 missense unknown
R8051:Lrrc37a UTSW 11 103503126 missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103457422 missense unknown
R8097:Lrrc37a UTSW 11 103504099 missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103503057 missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103497898 missense unknown
R8311:Lrrc37a UTSW 11 103503421 missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103501585 missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103460809 missense unknown
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103456486 missense probably damaging 1.00
Z1176:Lrrc37a UTSW 11 103499034 missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103501094 missense probably benign 0.09
Z1177:Lrrc37a UTSW 11 103499967 missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103500520 missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103500598 missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103503027 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACTGTGTAGTCTCTGAGTGAGT -3'
(R):5'- TCCTGCATGGAAACCCAACT -3'

Sequencing Primer
(F):5'- CTCTGAGTGAGTAGTTGGTGAGGC -3'
(R):5'- TGCATGGAAACCCAACTCAAGTC -3'
Posted On2019-11-12