Incidental Mutation 'R7686:Fam135b'
ID593118
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7686 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71463384 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 654 (K654E)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022953
AA Change: K654E

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: K654E

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,249,052 N208S probably benign Het
9930021J03Rik A T 19: 29,717,470 I1541N probably benign Het
Acadl A T 1: 66,848,398 probably null Het
Adgrg5 A T 8: 94,937,802 I347F Het
Agmo T C 12: 37,419,974 V431A probably benign Het
Arl14epl A G 18: 46,932,456 D96G probably damaging Het
Asxl1 C T 2: 153,391,614 S113F probably damaging Het
Axdnd1 A T 1: 156,395,464 C81* probably null Het
Bloc1s3 C T 7: 19,507,606 probably benign Het
Bmper C G 9: 23,399,544 L425V probably benign Het
Bok A T 1: 93,695,100 T194S probably benign Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Brpf3 T C 17: 28,806,934 I327T probably damaging Het
Camk1 T A 6: 113,336,197 N297Y probably damaging Het
Catsper2 C T 2: 121,397,456 probably null Het
Ccdc171 A T 4: 83,657,319 N480I unknown Het
Cd163l1 T A 7: 140,222,203 C148* probably null Het
Cd83 A G 13: 43,785,372 M22V probably benign Het
Col1a2 A G 6: 4,518,964 D243G unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Ctla4 A T 1: 60,912,593 T94S probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Dhx32 A T 7: 133,759,701 M1K probably null Het
Epha3 T A 16: 63,773,288 I146F probably damaging Het
Erbb2 T A 11: 98,435,573 S1008T probably benign Het
Esp34 A G 17: 38,559,643 R143G possibly damaging Het
Fgr T C 4: 132,998,013 M343T probably benign Het
Fibcd1 T G 2: 31,833,868 D253A probably damaging Het
Foxk1 C T 5: 142,401,870 S116L probably damaging Het
Gimap8 G A 6: 48,656,072 G275E probably damaging Het
Glp1r T C 17: 30,925,659 Y269H probably damaging Het
Gm5136 T C 10: 108,699,440 E218G probably damaging Het
Gm9008 A T 6: 76,497,030 L201H probably damaging Het
Hist2h2ac T C 3: 96,220,570 E92G probably damaging Het
Lbr A G 1: 181,817,521 F522S probably damaging Het
Lca5 T C 9: 83,395,239 N684S probably benign Het
Leng8 C A 7: 4,143,505 S372* probably null Het
Lrp2 A G 2: 69,489,237 Y1981H probably damaging Het
Lrrc37a T G 11: 103,498,236 Q2121P unknown Het
Lrrn2 A G 1: 132,938,594 T466A probably benign Het
Map3k19 A T 1: 127,822,248 L1122* probably null Het
Mfsd6 T C 1: 52,662,395 E632G probably benign Het
Mfsd6l C T 11: 68,557,226 A301V probably benign Het
Mro A T 18: 73,877,439 M197L probably benign Het
Ncam2 A T 16: 81,621,454 E799V probably damaging Het
Nek9 A T 12: 85,303,659 D880E probably benign Het
Ntng1 T A 3: 109,935,014 I148L possibly damaging Het
Olfr1378 A G 11: 50,969,755 T246A possibly damaging Het
Olfr205 T A 16: 59,329,016 R164S probably damaging Het
P2ry13 C T 3: 59,210,018 G113D probably damaging Het
Pnpt1 A T 11: 29,157,070 T687S probably damaging Het
Pou2af1 T C 9: 51,238,186 Y193H probably damaging Het
Ppp1r14c T A 10: 3,463,396 I143N probably damaging Het
Ppp1r16a A T 15: 76,694,583 S496C probably benign Het
Prdm12 G A 2: 31,640,217 R40Q probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 C A 16: 73,958,405 V743F probably damaging Het
Smg1 A T 7: 118,167,858 Y1804N unknown Het
Ssh2 A G 11: 77,425,324 E257G possibly damaging Het
Stoml3 T C 3: 53,503,168 I101T probably damaging Het
Stxbp5 T C 10: 9,769,410 D950G probably damaging Het
Syt10 T C 15: 89,814,157 D328G probably damaging Het
Taf3 T C 2: 9,951,488 K623E probably damaging Het
Tas2r134 T A 2: 51,628,243 S245T possibly damaging Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Tjp3 C T 10: 81,278,051 V458I probably benign Het
Tnpo3 G T 6: 29,562,900 S606* probably null Het
Tram1l1 T C 3: 124,321,310 F40L probably benign Het
Ttc29 A T 8: 78,393,130 T464S probably benign Het
Txndc9 A T 1: 37,987,768 M192K probably benign Het
Urb2 C A 8: 124,045,172 A1444E probably benign Het
Uty G A Y: 1,158,075 T657I possibly damaging Het
Vmn1r1 A T 1: 182,158,025 V25D probably damaging Het
Vmn2r65 A T 7: 84,940,536 I724N probably damaging Het
Xkr6 C T 14: 63,606,846 T106M possibly damaging Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp341 A G 2: 154,624,861 E50G probably damaging Het
Zfp62 C A 11: 49,217,158 A692E probably damaging Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R7949:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
R8167:Fam135b UTSW 15 71532991 missense probably null 1.00
R8252:Fam135b UTSW 15 71533023 missense probably benign 0.10
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- AAAGAGTTCCTGTGGTGCGC -3'
(R):5'- CCAAGCAAAGTTGTAGCAGG -3'

Sequencing Primer
(F):5'- CTGATGTAAGACGTCACGATCACTG -3'
(R):5'- TAGCAGGAACAAGCCAGAATAATTC -3'
Posted On2019-11-12