Incidental Mutation 'R7686:Ppp1r16a'
ID 593119
Institutional Source Beutler Lab
Gene Symbol Ppp1r16a
Ensembl Gene ENSMUSG00000033819
Gene Name protein phosphatase 1, regulatory (inhibitor) subunit 16A
Synonyms R75527, Mypt3, 2900084E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7686 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76671615-76694919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76694583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 496 (S496C)
Ref Sequence ENSEMBL: ENSMUSP00000037356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023203] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000231028]
AlphaFold Q923M0
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037551
AA Change: S496C

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819
AA Change: S496C

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135388
AA Change: S496C

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156920
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A G 7: 140,249,052 N208S probably benign Het
9930021J03Rik A T 19: 29,717,470 I1541N probably benign Het
Acadl A T 1: 66,848,398 probably null Het
Adgrg5 A T 8: 94,937,802 I347F Het
Agmo T C 12: 37,419,974 V431A probably benign Het
Arl14epl A G 18: 46,932,456 D96G probably damaging Het
Asxl1 C T 2: 153,391,614 S113F probably damaging Het
Axdnd1 A T 1: 156,395,464 C81* probably null Het
Bloc1s3 C T 7: 19,507,606 probably benign Het
Bmper C G 9: 23,399,544 L425V probably benign Het
Bok A T 1: 93,695,100 T194S probably benign Het
Bpifa5 A T 2: 154,165,512 I125L probably benign Het
Brpf3 T C 17: 28,806,934 I327T probably damaging Het
Camk1 T A 6: 113,336,197 N297Y probably damaging Het
Catsper2 C T 2: 121,397,456 probably null Het
Ccdc171 A T 4: 83,657,319 N480I unknown Het
Cd163l1 T A 7: 140,222,203 C148* probably null Het
Cd83 A G 13: 43,785,372 M22V probably benign Het
Col1a2 A G 6: 4,518,964 D243G unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Ctla4 A T 1: 60,912,593 T94S probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Dhx32 A T 7: 133,759,701 M1K probably null Het
Epha3 T A 16: 63,773,288 I146F probably damaging Het
Erbb2 T A 11: 98,435,573 S1008T probably benign Het
Esp34 A G 17: 38,559,643 R143G possibly damaging Het
Fam135b T C 15: 71,463,384 K654E possibly damaging Het
Fgr T C 4: 132,998,013 M343T probably benign Het
Fibcd1 T G 2: 31,833,868 D253A probably damaging Het
Foxk1 C T 5: 142,401,870 S116L probably damaging Het
Gimap8 G A 6: 48,656,072 G275E probably damaging Het
Glp1r T C 17: 30,925,659 Y269H probably damaging Het
Gm5136 T C 10: 108,699,440 E218G probably damaging Het
Gm9008 A T 6: 76,497,030 L201H probably damaging Het
Hist2h2ac T C 3: 96,220,570 E92G probably damaging Het
Lbr A G 1: 181,817,521 F522S probably damaging Het
Lca5 T C 9: 83,395,239 N684S probably benign Het
Leng8 C A 7: 4,143,505 S372* probably null Het
Lrp2 A G 2: 69,489,237 Y1981H probably damaging Het
Lrrc37a T G 11: 103,498,236 Q2121P unknown Het
Lrrn2 A G 1: 132,938,594 T466A probably benign Het
Map3k19 A T 1: 127,822,248 L1122* probably null Het
Mfsd6 T C 1: 52,662,395 E632G probably benign Het
Mfsd6l C T 11: 68,557,226 A301V probably benign Het
Mro A T 18: 73,877,439 M197L probably benign Het
Ncam2 A T 16: 81,621,454 E799V probably damaging Het
Nek9 A T 12: 85,303,659 D880E probably benign Het
Ntng1 T A 3: 109,935,014 I148L possibly damaging Het
Olfr1378 A G 11: 50,969,755 T246A possibly damaging Het
Olfr205 T A 16: 59,329,016 R164S probably damaging Het
P2ry13 C T 3: 59,210,018 G113D probably damaging Het
Pnpt1 A T 11: 29,157,070 T687S probably damaging Het
Pou2af1 T C 9: 51,238,186 Y193H probably damaging Het
Ppp1r14c T A 10: 3,463,396 I143N probably damaging Het
Prdm12 G A 2: 31,640,217 R40Q probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 C A 16: 73,958,405 V743F probably damaging Het
Smg1 A T 7: 118,167,858 Y1804N unknown Het
Ssh2 A G 11: 77,425,324 E257G possibly damaging Het
Stoml3 T C 3: 53,503,168 I101T probably damaging Het
Stxbp5 T C 10: 9,769,410 D950G probably damaging Het
Syt10 T C 15: 89,814,157 D328G probably damaging Het
Taf3 T C 2: 9,951,488 K623E probably damaging Het
Tas2r134 T A 2: 51,628,243 S245T possibly damaging Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Tjp3 C T 10: 81,278,051 V458I probably benign Het
Tnpo3 G T 6: 29,562,900 S606* probably null Het
Tram1l1 T C 3: 124,321,310 F40L probably benign Het
Ttc29 A T 8: 78,393,130 T464S probably benign Het
Txndc9 A T 1: 37,987,768 M192K probably benign Het
Urb2 C A 8: 124,045,172 A1444E probably benign Het
Uty G A Y: 1,158,075 T657I possibly damaging Het
Vmn1r1 A T 1: 182,158,025 V25D probably damaging Het
Vmn2r65 A T 7: 84,940,536 I724N probably damaging Het
Xkr6 C T 14: 63,606,846 T106M possibly damaging Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp341 A G 2: 154,624,861 E50G probably damaging Het
Zfp62 C A 11: 49,217,158 A692E probably damaging Het
Other mutations in Ppp1r16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Ppp1r16a APN 15 76694544 missense probably benign
IGL01449:Ppp1r16a APN 15 76694294 unclassified probably benign
IGL02128:Ppp1r16a APN 15 76693978 missense probably benign
IGL02331:Ppp1r16a APN 15 76691000 missense probably benign
R0057:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0060:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0113:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0114:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0244:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0352:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0646:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0652:Ppp1r16a UTSW 15 76690799 unclassified probably benign
R0722:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0744:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0833:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0834:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0835:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0836:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0885:Ppp1r16a UTSW 15 76693669 nonsense probably null
R0942:Ppp1r16a UTSW 15 76694011 missense probably damaging 0.98
R1061:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1168:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1170:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1171:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1503:Ppp1r16a UTSW 15 76694399 missense probably benign
R1572:Ppp1r16a UTSW 15 76693669 nonsense probably null
R1914:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R1915:Ppp1r16a UTSW 15 76693068 missense probably damaging 1.00
R2085:Ppp1r16a UTSW 15 76693596 missense probably damaging 0.99
R4823:Ppp1r16a UTSW 15 76693193 unclassified probably benign
R5153:Ppp1r16a UTSW 15 76694396 nonsense probably null
R5443:Ppp1r16a UTSW 15 76694646 missense possibly damaging 0.95
R5481:Ppp1r16a UTSW 15 76691021 missense probably damaging 1.00
R6900:Ppp1r16a UTSW 15 76691723 missense probably damaging 1.00
R7165:Ppp1r16a UTSW 15 76690904 missense probably damaging 1.00
R8138:Ppp1r16a UTSW 15 76691721 missense probably damaging 1.00
R9150:Ppp1r16a UTSW 15 76690854 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCGTCTAGATCGGAGTGTCTC -3'
(R):5'- CACAGGGGTATGTGCTAAGTG -3'

Sequencing Primer
(F):5'- CTATCATCTGAGTCCTGAGGAGAAC -3'
(R):5'- ATGTGCTAAGTGGGTCACC -3'
Posted On 2019-11-12