Incidental Mutation 'R7687:Pbxip1'
ID 593137
Institutional Source Beutler Lab
Gene Symbol Pbxip1
Ensembl Gene ENSMUSG00000042613
Gene Name pre B cell leukemia transcription factor interacting protein 1
Synonyms 4732463H20Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 89344013-89358259 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89355506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 675 (D675G)
Ref Sequence ENSEMBL: ENSMUSP00000040429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]
AlphaFold Q3TVI8
Predicted Effect probably damaging
Transcript: ENSMUST00000038942
AA Change: D675G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613
AA Change: D675G

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130858
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Pbxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Pbxip1 APN 3 89,350,897 (GRCm39) splice site probably benign
IGL02612:Pbxip1 APN 3 89,350,988 (GRCm39) missense probably damaging 1.00
IGL02718:Pbxip1 APN 3 89,355,311 (GRCm39) missense probably damaging 1.00
R0538:Pbxip1 UTSW 3 89,354,926 (GRCm39) missense possibly damaging 0.79
R0549:Pbxip1 UTSW 3 89,350,899 (GRCm39) splice site probably benign
R1460:Pbxip1 UTSW 3 89,352,921 (GRCm39) missense probably damaging 1.00
R1931:Pbxip1 UTSW 3 89,354,984 (GRCm39) splice site probably null
R1966:Pbxip1 UTSW 3 89,352,795 (GRCm39) missense probably damaging 1.00
R2008:Pbxip1 UTSW 3 89,356,020 (GRCm39) missense probably benign 0.20
R3435:Pbxip1 UTSW 3 89,354,543 (GRCm39) missense probably damaging 0.99
R4504:Pbxip1 UTSW 3 89,353,690 (GRCm39) missense possibly damaging 0.48
R4591:Pbxip1 UTSW 3 89,353,467 (GRCm39) missense probably benign 0.33
R5491:Pbxip1 UTSW 3 89,350,466 (GRCm39) missense probably benign 0.09
R6051:Pbxip1 UTSW 3 89,350,477 (GRCm39) missense probably benign 0.08
R6620:Pbxip1 UTSW 3 89,355,133 (GRCm39) missense probably benign 0.12
R7203:Pbxip1 UTSW 3 89,354,735 (GRCm39) missense possibly damaging 0.68
R7259:Pbxip1 UTSW 3 89,352,940 (GRCm39) missense probably benign
R7604:Pbxip1 UTSW 3 89,352,902 (GRCm39) missense probably benign 0.01
R7710:Pbxip1 UTSW 3 89,355,408 (GRCm39) missense probably damaging 1.00
R7980:Pbxip1 UTSW 3 89,353,648 (GRCm39) missense probably benign 0.44
R8218:Pbxip1 UTSW 3 89,352,902 (GRCm39) missense probably benign
R8754:Pbxip1 UTSW 3 89,355,235 (GRCm39) missense probably damaging 1.00
R8923:Pbxip1 UTSW 3 89,352,921 (GRCm39) missense possibly damaging 0.78
R8951:Pbxip1 UTSW 3 89,352,864 (GRCm39) missense probably benign 0.05
R9043:Pbxip1 UTSW 3 89,350,794 (GRCm39) missense probably benign
R9253:Pbxip1 UTSW 3 89,351,012 (GRCm39) missense probably benign 0.01
R9398:Pbxip1 UTSW 3 89,354,941 (GRCm39) missense probably benign 0.06
R9651:Pbxip1 UTSW 3 89,352,795 (GRCm39) missense probably damaging 1.00
R9657:Pbxip1 UTSW 3 89,355,056 (GRCm39) missense probably benign
X0012:Pbxip1 UTSW 3 89,353,690 (GRCm39) missense possibly damaging 0.48
X0012:Pbxip1 UTSW 3 89,352,830 (GRCm39) missense possibly damaging 0.91
Z1177:Pbxip1 UTSW 3 89,354,527 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAATACTTGTCTCGGCTGCC -3'
(R):5'- TCATGGGAAGATAGGATGTGTACC -3'

Sequencing Primer
(F):5'- GTCTCGGCTGCCCTGGG -3'
(R):5'- TAGGATGTGTACCCAGAAGCCTTC -3'
Posted On 2019-11-12