Incidental Mutation 'R7687:Pbxip1'
ID593137
Institutional Source Beutler Lab
Gene Symbol Pbxip1
Ensembl Gene ENSMUSG00000042613
Gene Namepre B cell leukemia transcription factor interacting protein 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89436706-89450952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89448199 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 675 (D675G)
Ref Sequence ENSEMBL: ENSMUSP00000040429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]
Predicted Effect probably damaging
Transcript: ENSMUST00000038942
AA Change: D675G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613
AA Change: D675G

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130858
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145753
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Pbxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Pbxip1 APN 3 89443590 splice site probably benign
IGL02612:Pbxip1 APN 3 89443681 missense probably damaging 1.00
IGL02718:Pbxip1 APN 3 89448004 missense probably damaging 1.00
R0538:Pbxip1 UTSW 3 89447619 missense possibly damaging 0.79
R0549:Pbxip1 UTSW 3 89443592 splice site probably benign
R1460:Pbxip1 UTSW 3 89445614 missense probably damaging 1.00
R1931:Pbxip1 UTSW 3 89447677 splice site probably null
R1966:Pbxip1 UTSW 3 89445488 missense probably damaging 1.00
R2008:Pbxip1 UTSW 3 89448713 missense probably benign 0.20
R3435:Pbxip1 UTSW 3 89447236 missense probably damaging 0.99
R4504:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
R4591:Pbxip1 UTSW 3 89446160 missense probably benign 0.33
R5491:Pbxip1 UTSW 3 89443159 missense probably benign 0.09
R6051:Pbxip1 UTSW 3 89443170 missense probably benign 0.08
R6620:Pbxip1 UTSW 3 89447826 missense probably benign 0.12
R7203:Pbxip1 UTSW 3 89447428 missense possibly damaging 0.68
R7259:Pbxip1 UTSW 3 89445633 missense probably benign
R7604:Pbxip1 UTSW 3 89445595 missense probably benign 0.01
R7710:Pbxip1 UTSW 3 89448101 missense probably damaging 1.00
R7980:Pbxip1 UTSW 3 89446341 missense probably benign 0.44
R8218:Pbxip1 UTSW 3 89445595 missense probably benign
X0012:Pbxip1 UTSW 3 89445523 missense possibly damaging 0.91
X0012:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
Z1177:Pbxip1 UTSW 3 89447220 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AGAATACTTGTCTCGGCTGCC -3'
(R):5'- TCATGGGAAGATAGGATGTGTACC -3'

Sequencing Primer
(F):5'- GTCTCGGCTGCCCTGGG -3'
(R):5'- TAGGATGTGTACCCAGAAGCCTTC -3'
Posted On2019-11-12