Incidental Mutation 'R7687:Kcnc4'
ID593138
Institutional Source Beutler Lab
Gene Symbol Kcnc4
Ensembl Gene ENSMUSG00000027895
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 4
SynonymsKcr2-4, Kv3.4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7687 (G1)
Quality Score217.468
Status Not validated
Chromosome3
Chromosomal Location107438303-107459552 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CCCGCCGCCGCCGCCGCCGCCGC to CCCGCCGCCGCCGCCGCCGCCGCCGC at 107458609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000009617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009617]
Predicted Effect probably benign
Transcript: ENSMUST00000009617
SMART Domains Protein: ENSMUSP00000009617
Gene: ENSMUSG00000027895

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 29 3e-23 PFAM
BTB 36 155 4.66e-16 SMART
low complexity region 168 185 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
Pfam:Ion_trans 229 487 2.6e-46 PFAM
Pfam:Ion_trans_2 386 480 3e-12 PFAM
low complexity region 489 505 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Kcnc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnc4 APN 3 107447873 missense probably benign 0.01
IGL00899:Kcnc4 APN 3 107458463 missense possibly damaging 0.94
IGL01755:Kcnc4 APN 3 107448175 missense probably damaging 1.00
IGL01895:Kcnc4 APN 3 107448218 missense probably benign 0.01
IGL02741:Kcnc4 APN 3 107447978 missense probably damaging 0.98
IGL03393:Kcnc4 APN 3 107447927 missense possibly damaging 0.75
PIT4151001:Kcnc4 UTSW 3 107458703 missense probably damaging 1.00
PIT4378001:Kcnc4 UTSW 3 107447563 missense probably benign
R0158:Kcnc4 UTSW 3 107458604 missense probably benign 0.21
R0415:Kcnc4 UTSW 3 107445433 missense probably damaging 1.00
R0704:Kcnc4 UTSW 3 107447963 missense possibly damaging 0.92
R0747:Kcnc4 UTSW 3 107448154 missense probably damaging 1.00
R1481:Kcnc4 UTSW 3 107448218 missense probably benign 0.02
R1540:Kcnc4 UTSW 3 107445427 splice site probably null
R1602:Kcnc4 UTSW 3 107448204 missense possibly damaging 0.96
R2422:Kcnc4 UTSW 3 107445547 missense probably benign 0.30
R3750:Kcnc4 UTSW 3 107448190 missense probably benign 0.36
R4791:Kcnc4 UTSW 3 107447543 missense probably benign 0.32
R4815:Kcnc4 UTSW 3 107458266 missense probably benign 0.37
R5216:Kcnc4 UTSW 3 107439441 missense probably benign
R5259:Kcnc4 UTSW 3 107448085 missense probably damaging 1.00
R5317:Kcnc4 UTSW 3 107458739 missense probably damaging 0.98
R5474:Kcnc4 UTSW 3 107447891 missense possibly damaging 0.82
R5783:Kcnc4 UTSW 3 107447872 missense possibly damaging 0.69
R5865:Kcnc4 UTSW 3 107458199 critical splice donor site probably null
R6228:Kcnc4 UTSW 3 107448377 missense probably damaging 0.99
R6536:Kcnc4 UTSW 3 107448196 missense possibly damaging 0.81
R7018:Kcnc4 UTSW 3 107458862 missense probably benign 0.00
R7319:Kcnc4 UTSW 3 107458784 missense probably benign 0.21
R8436:Kcnc4 UTSW 3 107458768 missense probably damaging 0.96
X0020:Kcnc4 UTSW 3 107447651 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTCTCGAAGATGTCCAGTGC -3'
(R):5'- GCGTCGGAGAAGATCATCATCAAC -3'

Sequencing Primer
(F):5'- AAGATGTCCAGTGCCTCCTCAG -3'
(R):5'- ATCATCATCAACGTGGGCG -3'
Posted On2019-11-12