Mutagenetix > Incidental Mutations

Incidental Mutation 'R7687:Kcnc4'

593138

Institutional Source

Beutler Lab

Gene Symbol

Kcnc4

Ensembl Gene

ENSMUSG00000027895

Gene Name

potassium voltage gated channel, Shaw-related subfamily, member 4

Synonyms

Kcr2-4, Kv3.4

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R7687 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

107438303-107459552 bp(-) (GRCm38)

Type of Mutation

small insertion (1 aa in frame mutation)

DNA Base Change (assembly)

CCCGCCGCCGCCGCCGCCGCCGC to CCCGCCGCCGCCGCCGCCGCCGCCGC at 107458609 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000009617 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009617]

Predicted Effect

probably benign
Transcript: ENSMUST00000009617

SMART Domains

Protein: ENSMUSP00000009617
Gene: ENSMUSG00000027895

Domain	Start	End	E-Value	Type
Pfam:Potassium_chann	1	29	3e-23	PFAM
BTB	36	155	4.66e-16	SMART
low complexity region	168	185	N/A	INTRINSIC
low complexity region	194	211	N/A	INTRINSIC
Pfam:Ion_trans	229	487	2.6e-46	PFAM
Pfam:Ion_trans_2	386	480	3e-12	PFAM
low complexity region	489	505	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,258,182	K2383R	probably benign	Het
Acly	C	T	11: 100,504,854		probably null	Het
Baiap3	T	A	17: 25,249,337	I276F	possibly damaging	Het
Cdc14b	A	T	13: 64,209,193	D419E	probably benign	Het
Celsr2	G	T	3: 108,397,769	P2165T	probably benign	Het
Clk4	A	G	11: 51,281,398	D476G	probably benign	Het
Dera	A	G	6: 137,836,880	T10A		Het
Dip2c	A	T	13: 9,604,581	T742S	probably benign	Het
Dohh	C	A	10: 81,387,806	A231E	probably benign	Het
Dot1l	T	G	10: 80,789,368	S1150A	possibly damaging	Het
Eea1	T	A	10: 96,026,598	I794N	probably benign	Het
En2	T	C	5: 28,170,289	S277P	probably damaging	Het
Erich1	A	G	8: 14,030,691	L276P	probably damaging	Het
Flnb	A	G	14: 7,924,224	N1779S	probably damaging	Het
Frzb	T	A	2: 80,424,635	T186S	probably benign	Het
Gdf7	T	A	12: 8,298,257	R347*	probably null	Het
Ighv9-4	T	C	12: 114,300,263	I17V	not run	Het
Ipo13	G	A	4: 117,911,891	P235S	probably benign	Het
Itga2	C	A	13: 114,866,260	G565C	probably damaging	Het
Kcnk10	A	G	12: 98,435,096	I440T	probably damaging	Het
Kdm3a	T	A	6: 71,599,492	K779N	possibly damaging	Het
Kmt2d	C	T	15: 98,862,120	D1086N	unknown	Het
Kntc1	A	G	5: 123,759,089	I172V	probably benign	Het
Maip1	A	G	1: 57,411,844	E215G	probably damaging	Het
Mms19	A	T	19: 41,955,168	M417K	possibly damaging	Het
Mslnl	T	C	17: 25,743,183	V185A	probably damaging	Het
Naa11	A	T	5: 97,391,789	V170E	probably benign	Het
Ncapg	C	T	5: 45,699,885	P980S	probably benign	Het
Olfr170	T	C	16: 19,605,735	N310S	probably benign	Het
Pbxip1	A	G	3: 89,448,199	D675G	probably damaging	Het
Pdlim5	A	G	3: 142,277,847	S382P	probably benign	Het
Pkd1l1	T	A	11: 8,854,390	I2184F		Het
Plau	A	G	14: 20,839,798	Y237C	probably damaging	Het
Ppl	T	C	16: 5,097,942	T586A	probably benign	Het
Rapgef6	T	G	11: 54,661,075	I923S	possibly damaging	Het
Rbfox2	C	T	15: 77,306,494	G17D	unknown	Het
Sema3b	T	C	9: 107,603,814	D108G	probably damaging	Het
Slc6a20a	A	G	9: 123,656,266	I297T	probably damaging	Het
Slit1	A	G	19: 41,650,689	F261L	probably benign	Het
Tcp10a	T	A	17: 7,345,108	V433D	probably damaging	Het
Tktl2	A	G	8: 66,513,101	E437G	probably damaging	Het
Tll1	G	T	8: 64,121,492	Y109*	probably null	Het
Tmem79	A	G	3: 88,332,581	V274A	probably damaging	Het
Tnfrsf23	G	A	7: 143,681,462	S55L	probably benign	Het
Ubd	T	C	17: 37,193,974		probably null	Het
Ubl3	C	A	5: 148,506,175	R105L	possibly damaging	Het
Ubl7	A	T	9: 57,914,584	D72V	probably damaging	Het
Wdr55	T	C	18: 36,762,023	S81P	probably damaging	Het
Wtip	T	C	7: 34,116,619	Y344C	probably damaging	Het
Zfp488	A	G	14: 33,970,400	S269P	possibly damaging	Het
Zkscan2	A	C	7: 123,499,862	S36A	probably benign	Het

Other mutations in Kcnc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Kcnc4	APN	3	107447873	missense	probably benign	0.01
IGL00899:Kcnc4	APN	3	107458463	missense	possibly damaging	0.94
IGL01755:Kcnc4	APN	3	107448175	missense	probably damaging	1.00
IGL01895:Kcnc4	APN	3	107448218	missense	probably benign	0.01
IGL02741:Kcnc4	APN	3	107447978	missense	probably damaging	0.98
IGL03393:Kcnc4	APN	3	107447927	missense	possibly damaging	0.75
PIT4151001:Kcnc4	UTSW	3	107458703	missense	probably damaging	1.00
PIT4378001:Kcnc4	UTSW	3	107447563	missense	probably benign
R0158:Kcnc4	UTSW	3	107458604	missense	probably benign	0.21
R0415:Kcnc4	UTSW	3	107445433	missense	probably damaging	1.00
R0704:Kcnc4	UTSW	3	107447963	missense	possibly damaging	0.92
R0747:Kcnc4	UTSW	3	107448154	missense	probably damaging	1.00
R1481:Kcnc4	UTSW	3	107448218	missense	probably benign	0.02
R1540:Kcnc4	UTSW	3	107445427	splice site	probably null
R1602:Kcnc4	UTSW	3	107448204	missense	possibly damaging	0.96
R2422:Kcnc4	UTSW	3	107445547	missense	probably benign	0.30
R3750:Kcnc4	UTSW	3	107448190	missense	probably benign	0.36
R4791:Kcnc4	UTSW	3	107447543	missense	probably benign	0.32
R4815:Kcnc4	UTSW	3	107458266	missense	probably benign	0.37
R5216:Kcnc4	UTSW	3	107439441	missense	probably benign
R5259:Kcnc4	UTSW	3	107448085	missense	probably damaging	1.00
R5317:Kcnc4	UTSW	3	107458739	missense	probably damaging	0.98
R5474:Kcnc4	UTSW	3	107447891	missense	possibly damaging	0.82
R5783:Kcnc4	UTSW	3	107447872	missense	possibly damaging	0.69
R5865:Kcnc4	UTSW	3	107458199	critical splice donor site	probably null
R6228:Kcnc4	UTSW	3	107448377	missense	probably damaging	0.99
R6536:Kcnc4	UTSW	3	107448196	missense	possibly damaging	0.81
R7018:Kcnc4	UTSW	3	107458862	missense	probably benign	0.00
R7319:Kcnc4	UTSW	3	107458784	missense	probably benign	0.21
R8436:Kcnc4	UTSW	3	107458768	missense	probably damaging	0.96
X0020:Kcnc4	UTSW	3	107447651	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CTCTCGAAGATGTCCAGTGC -3'
(R):5'- GCGTCGGAGAAGATCATCATCAAC -3'

Sequencing Primer
(F):5'- AAGATGTCCAGTGCCTCCTCAG -3'
(R):5'- ATCATCATCAACGTGGGCG -3'

Posted On

2019-11-12