Incidental Mutation 'R7687:Pdlim5'
ID593140
Institutional Source Beutler Lab
Gene Symbol Pdlim5
Ensembl Gene ENSMUSG00000028273
Gene NamePDZ and LIM domain 5
SynonymsEnh3, Enh, Enh2, 1110001A05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location142239590-142395696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142277847 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 382 (S382P)
Ref Sequence ENSEMBL: ENSMUSP00000142737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029941] [ENSMUST00000195975] [ENSMUST00000196220] [ENSMUST00000198381] [ENSMUST00000200043]
Predicted Effect probably benign
Transcript: ENSMUST00000029941
AA Change: S359P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029941
Gene: ENSMUSG00000028273
AA Change: S359P

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Pfam:DUF4749 212 305 1.3e-9 PFAM
low complexity region 310 339 N/A INTRINSIC
LIM 414 465 3.17e-17 SMART
LIM 473 524 4.62e-19 SMART
LIM 532 585 1.79e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195975
AA Change: S382P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142737
Gene: ENSMUSG00000028273
AA Change: S382P

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 237 246 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
low complexity region 333 362 N/A INTRINSIC
LIM 437 488 3.17e-17 SMART
LIM 496 547 4.62e-19 SMART
LIM 555 608 1.79e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196220
AA Change: S342P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142460
Gene: ENSMUSG00000028273
AA Change: S342P

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
low complexity region 293 322 N/A INTRINSIC
LIM 397 448 3.17e-17 SMART
LIM 456 507 4.62e-19 SMART
LIM 515 568 1.79e-16 SMART
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000198381
AA Change: S250P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142899
Gene: ENSMUSG00000028273
AA Change: S250P

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 201 230 N/A INTRINSIC
LIM 305 356 3.17e-17 SMART
LIM 364 415 4.62e-19 SMART
LIM 423 476 1.79e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000200043
AA Change: S294P
SMART Domains Protein: ENSMUSP00000143343
Gene: ENSMUSG00000028273
AA Change: S294P

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 228 243 N/A INTRINSIC
low complexity region 245 274 N/A INTRINSIC
LIM 349 400 3.17e-17 SMART
LIM 408 459 4.62e-19 SMART
LIM 467 520 1.79e-16 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cardiac muscle contractility, wider Z-lines, and dilated cardiomyopathy. Mice heterozygous for a gene trap allele exhibit impaired response to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Pdlim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Pdlim5 APN 3 142352787 missense probably damaging 1.00
R1868:Pdlim5 UTSW 3 142306299 critical splice acceptor site probably null
R1937:Pdlim5 UTSW 3 142244981 missense possibly damaging 0.46
R3000:Pdlim5 UTSW 3 142312131 missense probably damaging 1.00
R4477:Pdlim5 UTSW 3 142259217 missense probably benign 0.09
R4959:Pdlim5 UTSW 3 142311979 intron probably benign
R4973:Pdlim5 UTSW 3 142311979 intron probably benign
R5135:Pdlim5 UTSW 3 142304365 missense probably benign 0.34
R5393:Pdlim5 UTSW 3 142259186 missense probably damaging 1.00
R5445:Pdlim5 UTSW 3 142352734 missense probably null 1.00
R5707:Pdlim5 UTSW 3 142304299 missense probably damaging 1.00
R6154:Pdlim5 UTSW 3 142277913 missense possibly damaging 0.68
R6269:Pdlim5 UTSW 3 142312325 missense possibly damaging 0.57
R6395:Pdlim5 UTSW 3 142314422 missense probably damaging 1.00
R6600:Pdlim5 UTSW 3 142259278 missense probably damaging 1.00
R6911:Pdlim5 UTSW 3 142304315 missense probably damaging 0.98
R7135:Pdlim5 UTSW 3 142311922 splice site probably null
R7283:Pdlim5 UTSW 3 142311980 critical splice acceptor site probably null
R7334:Pdlim5 UTSW 3 142244917 missense probably damaging 1.00
R7660:Pdlim5 UTSW 3 142259185 missense probably damaging 1.00
R7696:Pdlim5 UTSW 3 142277862 missense probably benign 0.08
R7779:Pdlim5 UTSW 3 142242686 missense probably benign 0.27
R7904:Pdlim5 UTSW 3 142312393 missense probably damaging 1.00
R8171:Pdlim5 UTSW 3 142312187 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAGACATTCGGAAGAGC -3'
(R):5'- TGGCTGAACTAGATTGATCCCC -3'

Sequencing Primer
(F):5'- CATTCGGAAGAGCAAAGCAGCTG -3'
(R):5'- GCTGAACTAGATTGATCCCCCTCAC -3'
Posted On2019-11-12