Incidental Mutation 'R7687:En2'
ID 593142
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
Accession Numbers
Essential gene? Possibly essential (E-score: 0.699) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 28370692-28377164 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28375287 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 277 (S277P)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect probably damaging
Transcript: ENSMUST00000036177
AA Change: S277P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: S277P

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28,371,524 (GRCm39) utr 5 prime probably benign
R0928:En2 UTSW 5 28,375,329 (GRCm39) nonsense probably null
R2083:En2 UTSW 5 28,372,071 (GRCm39) missense probably damaging 0.98
R2356:En2 UTSW 5 28,371,330 (GRCm39) start gained probably benign
R2762:En2 UTSW 5 28,375,419 (GRCm39) missense probably damaging 0.99
R5470:En2 UTSW 5 28,371,922 (GRCm39) missense probably benign 0.03
R5760:En2 UTSW 5 28,371,997 (GRCm39) missense probably benign 0.41
R6762:En2 UTSW 5 28,375,351 (GRCm39) missense possibly damaging 0.65
R7640:En2 UTSW 5 28,375,164 (GRCm39) nonsense probably null
R7827:En2 UTSW 5 28,371,594 (GRCm39) missense probably benign
R8409:En2 UTSW 5 28,371,882 (GRCm39) missense probably benign
R8861:En2 UTSW 5 28,371,733 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCATGACAACCAGGTC -3'
(R):5'- ACACTGGCCTTTTGTTCACG -3'

Sequencing Primer
(F):5'- TGACAACCAGGTCCCAGGTC -3'
(R):5'- AAATTATTGCATTGTTTCTCGCGGC -3'
Posted On 2019-11-12