Incidental Mutation 'R7687:Ncapg'
ID593143
Institutional Source Beutler Lab
Gene Symbol Ncapg
Ensembl Gene ENSMUSG00000015880
Gene Namenon-SMC condensin I complex, subunit G
Synonyms5730507H05Rik, MFT.M05.13, Hcapg
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location45669919-45700546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45699885 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 980 (P980S)
Ref Sequence ENSEMBL: ENSMUSP00000112871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045586] [ENSMUST00000117396] [ENSMUST00000121573] [ENSMUST00000190036]
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117396
AA Change: P980S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112871
Gene: ENSMUSG00000015880
AA Change: P980S

DomainStartEndE-ValueType
Pfam:Cnd3 557 863 7.4e-87 PFAM
low complexity region 864 874 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121573
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Ncapg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ncapg APN 5 45693160 missense possibly damaging 0.53
IGL00777:Ncapg APN 5 45695765 missense possibly damaging 0.93
IGL00857:Ncapg APN 5 45676585 splice site probably null
IGL00916:Ncapg APN 5 45671192 missense probably benign 0.37
IGL01293:Ncapg APN 5 45681854 missense probably benign 0.01
IGL01360:Ncapg APN 5 45674385 nonsense probably null
IGL01462:Ncapg APN 5 45671135 missense probably benign 0.02
IGL01527:Ncapg APN 5 45672384 missense possibly damaging 0.71
IGL01732:Ncapg APN 5 45693853 missense probably damaging 1.00
IGL01788:Ncapg APN 5 45671081 missense probably damaging 0.97
IGL01871:Ncapg APN 5 45688581 missense probably benign 0.09
IGL03106:Ncapg APN 5 45695668 missense probably damaging 1.00
IGL03124:Ncapg APN 5 45671209 missense probably benign
R0086:Ncapg UTSW 5 45676744 splice site probably null
R0109:Ncapg UTSW 5 45693748 splice site probably null
R0110:Ncapg UTSW 5 45693147 unclassified probably benign
R0377:Ncapg UTSW 5 45693817 missense probably benign
R0432:Ncapg UTSW 5 45672428 missense probably damaging 0.99
R0637:Ncapg UTSW 5 45687324 missense probably damaging 1.00
R0835:Ncapg UTSW 5 45681448 missense probably damaging 0.96
R0894:Ncapg UTSW 5 45679894 missense probably null 0.24
R1069:Ncapg UTSW 5 45675930 intron probably benign
R1216:Ncapg UTSW 5 45699919 missense possibly damaging 0.68
R1967:Ncapg UTSW 5 45699910 missense probably damaging 0.99
R2396:Ncapg UTSW 5 45678373 missense probably benign 0.00
R3157:Ncapg UTSW 5 45676058 missense probably benign
R3735:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3736:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3887:Ncapg UTSW 5 45674363 missense probably benign
R4371:Ncapg UTSW 5 45678455 missense probably benign
R4545:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4546:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4558:Ncapg UTSW 5 45676644 missense probably benign 0.00
R4615:Ncapg UTSW 5 45687399 missense probably benign 0.00
R4938:Ncapg UTSW 5 45671209 missense probably benign
R5839:Ncapg UTSW 5 45672278 missense probably damaging 0.99
R5871:Ncapg UTSW 5 45695697 missense probably damaging 1.00
R6086:Ncapg UTSW 5 45693236 missense probably damaging 1.00
R6418:Ncapg UTSW 5 45681816 missense probably damaging 1.00
R6617:Ncapg UTSW 5 45670132 missense probably benign 0.03
R7145:Ncapg UTSW 5 45670030 missense possibly damaging 0.82
R7408:Ncapg UTSW 5 45695793 missense probably benign 0.00
R7443:Ncapg UTSW 5 45672310 missense probably benign 0.31
R7463:Ncapg UTSW 5 45694092 splice site probably null
R7509:Ncapg UTSW 5 45696108 missense probably benign 0.01
R7919:Ncapg UTSW 5 45696048 missense probably benign 0.00
R8022:Ncapg UTSW 5 45681794 missense probably damaging 1.00
R8177:Ncapg UTSW 5 45693753 missense probably benign 0.00
R8261:Ncapg UTSW 5 45687388 missense possibly damaging 0.90
R8263:Ncapg UTSW 5 45691792 missense probably benign 0.44
R8324:Ncapg UTSW 5 45695668 missense probably damaging 1.00
R8333:Ncapg UTSW 5 45674463 missense probably damaging 0.96
RF019:Ncapg UTSW 5 45698856 missense probably benign 0.00
Z1088:Ncapg UTSW 5 45679880 missense probably damaging 1.00
Z1177:Ncapg UTSW 5 45672502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCACTTGGCAGGACACC -3'
(R):5'- CCTGAAACAGAGCAGGCTTTC -3'

Sequencing Primer
(F):5'- TTGGCAGGACACCCATCCAG -3'
(R):5'- ACAGAGCAGGCTTTCTGACTTTATC -3'
Posted On2019-11-12