Incidental Mutation 'R7687:Kntc1'
ID 593145
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Name kinetochore associated 1
Synonyms jgl
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 123887779-123959656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123897152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 172 (I172V)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
AlphaFold Q8C3Y4
Predicted Effect probably benign
Transcript: ENSMUST00000031366
AA Change: I172V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: I172V

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123,928,222 (GRCm39) missense probably benign 0.05
IGL00514:Kntc1 APN 5 123,929,590 (GRCm39) missense probably benign 0.00
IGL01103:Kntc1 APN 5 123,902,283 (GRCm39) missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123,900,666 (GRCm39) missense probably benign 0.01
IGL01357:Kntc1 APN 5 123,895,877 (GRCm39) missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123,896,546 (GRCm39) missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123,919,721 (GRCm39) missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123,903,068 (GRCm39) missense probably benign 0.02
IGL01595:Kntc1 APN 5 123,941,758 (GRCm39) missense probably benign 0.30
IGL01725:Kntc1 APN 5 123,902,253 (GRCm39) missense probably benign
IGL01916:Kntc1 APN 5 123,939,976 (GRCm39) missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123,949,439 (GRCm39) missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123,916,330 (GRCm39) missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123,904,021 (GRCm39) missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123,947,159 (GRCm39) missense probably benign 0.12
IGL02145:Kntc1 APN 5 123,900,661 (GRCm39) missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123,957,125 (GRCm39) missense probably benign 0.03
IGL02611:Kntc1 APN 5 123,950,128 (GRCm39) missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123,893,727 (GRCm39) splice site probably benign
IGL02737:Kntc1 APN 5 123,957,183 (GRCm39) missense probably benign 0.17
IGL02793:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02809:Kntc1 APN 5 123,914,645 (GRCm39) missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123,907,936 (GRCm39) missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02931:Kntc1 APN 5 123,937,874 (GRCm39) missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123,913,884 (GRCm39) missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123,896,543 (GRCm39) missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0017:Kntc1 UTSW 5 123,919,044 (GRCm39) missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123,903,120 (GRCm39) splice site probably benign
R0324:Kntc1 UTSW 5 123,916,175 (GRCm39) missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123,941,732 (GRCm39) missense probably benign 0.00
R0608:Kntc1 UTSW 5 123,924,137 (GRCm39) missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123,907,767 (GRCm39) missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123,928,979 (GRCm39) missense probably null
R0781:Kntc1 UTSW 5 123,937,965 (GRCm39) splice site probably benign
R0787:Kntc1 UTSW 5 123,934,167 (GRCm39) missense probably benign
R1250:Kntc1 UTSW 5 123,922,262 (GRCm39) missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123,948,925 (GRCm39) frame shift probably null
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1481:Kntc1 UTSW 5 123,916,338 (GRCm39) missense probably benign 0.00
R1572:Kntc1 UTSW 5 123,910,176 (GRCm39) missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123,896,540 (GRCm39) missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123,927,162 (GRCm39) missense probably benign 0.00
R1993:Kntc1 UTSW 5 123,948,874 (GRCm39) critical splice acceptor site probably null
R1993:Kntc1 UTSW 5 123,897,162 (GRCm39) critical splice donor site probably null
R2071:Kntc1 UTSW 5 123,932,340 (GRCm39) splice site probably null
R2237:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123,898,411 (GRCm39) missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123,902,212 (GRCm39) missense probably benign 0.01
R2442:Kntc1 UTSW 5 123,948,922 (GRCm39) missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123,916,410 (GRCm39) nonsense probably null
R2943:Kntc1 UTSW 5 123,935,847 (GRCm39) missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123,940,121 (GRCm39) missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123,900,661 (GRCm39) missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123,914,680 (GRCm39) missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123,905,842 (GRCm39) missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123,932,216 (GRCm39) missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123,950,706 (GRCm39) missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123,949,496 (GRCm39) missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123,903,086 (GRCm39) missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123,928,196 (GRCm39) nonsense probably null
R4847:Kntc1 UTSW 5 123,940,337 (GRCm39) missense probably benign 0.18
R4849:Kntc1 UTSW 5 123,897,128 (GRCm39) missense probably benign 0.02
R4904:Kntc1 UTSW 5 123,916,396 (GRCm39) missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123,940,309 (GRCm39) missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123,900,649 (GRCm39) missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123,919,118 (GRCm39) critical splice donor site probably null
R5171:Kntc1 UTSW 5 123,937,907 (GRCm39) missense probably benign 0.01
R5220:Kntc1 UTSW 5 123,950,160 (GRCm39) missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123,932,235 (GRCm39) missense probably benign 0.09
R5278:Kntc1 UTSW 5 123,919,077 (GRCm39) missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123,902,254 (GRCm39) missense probably benign 0.02
R5496:Kntc1 UTSW 5 123,922,245 (GRCm39) missense probably benign 0.00
R5503:Kntc1 UTSW 5 123,957,939 (GRCm39) missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123,957,120 (GRCm39) missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123,956,538 (GRCm39) missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123,903,070 (GRCm39) missense probably benign 0.00
R5757:Kntc1 UTSW 5 123,945,372 (GRCm39) critical splice donor site probably null
R5773:Kntc1 UTSW 5 123,932,220 (GRCm39) missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123,924,258 (GRCm39) missense probably benign 0.05
R6019:Kntc1 UTSW 5 123,900,579 (GRCm39) missense probably benign 0.03
R6230:Kntc1 UTSW 5 123,927,072 (GRCm39) splice site probably null
R6437:Kntc1 UTSW 5 123,907,754 (GRCm39) missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123,949,373 (GRCm39) missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123,939,888 (GRCm39) missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123,919,789 (GRCm39) missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123,925,036 (GRCm39) missense probably benign 0.18
R7381:Kntc1 UTSW 5 123,948,971 (GRCm39) missense probably benign 0.12
R7485:Kntc1 UTSW 5 123,925,019 (GRCm39) missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123,929,001 (GRCm39) missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123,954,818 (GRCm39) missense probably benign 0.05
R7798:Kntc1 UTSW 5 123,957,180 (GRCm39) missense possibly damaging 0.94
R7798:Kntc1 UTSW 5 123,924,357 (GRCm39) missense probably benign
R7871:Kntc1 UTSW 5 123,922,290 (GRCm39) missense probably damaging 1.00
R7876:Kntc1 UTSW 5 123,913,850 (GRCm39) missense probably damaging 1.00
R7947:Kntc1 UTSW 5 123,919,951 (GRCm39) missense unknown
R7997:Kntc1 UTSW 5 123,916,117 (GRCm39) missense probably damaging 0.96
R8231:Kntc1 UTSW 5 123,920,959 (GRCm39) missense possibly damaging 0.47
R8257:Kntc1 UTSW 5 123,896,586 (GRCm39) critical splice donor site probably null
R8345:Kntc1 UTSW 5 123,924,993 (GRCm39) missense probably benign 0.37
R8354:Kntc1 UTSW 5 123,916,330 (GRCm39) missense probably damaging 1.00
R8732:Kntc1 UTSW 5 123,928,180 (GRCm39) missense probably benign 0.00
R8754:Kntc1 UTSW 5 123,897,115 (GRCm39) missense probably benign 0.01
R8947:Kntc1 UTSW 5 123,925,041 (GRCm39) missense probably benign 0.01
R9041:Kntc1 UTSW 5 123,927,093 (GRCm39) missense probably benign 0.00
R9182:Kntc1 UTSW 5 123,940,355 (GRCm39) missense probably damaging 1.00
R9432:Kntc1 UTSW 5 123,925,112 (GRCm39) missense possibly damaging 0.93
R9460:Kntc1 UTSW 5 123,941,378 (GRCm39) nonsense probably null
R9468:Kntc1 UTSW 5 123,954,776 (GRCm39) missense probably damaging 1.00
R9643:Kntc1 UTSW 5 123,949,440 (GRCm39) missense probably damaging 1.00
R9646:Kntc1 UTSW 5 123,897,119 (GRCm39) missense probably benign 0.01
R9721:Kntc1 UTSW 5 123,939,948 (GRCm39) missense probably benign 0.01
R9789:Kntc1 UTSW 5 123,898,706 (GRCm39) missense possibly damaging 0.87
X0027:Kntc1 UTSW 5 123,948,992 (GRCm39) missense probably benign 0.00
X0065:Kntc1 UTSW 5 123,916,100 (GRCm39) nonsense probably null
X0067:Kntc1 UTSW 5 123,916,137 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGAGACTACTTTCCTGCTCAC -3'
(R):5'- AGGGTCACATGCACCATTC -3'

Sequencing Primer
(F):5'- GGAGCTTGGCAACCTGAATCTTTAC -3'
(R):5'- CCTCCAGTTAGTTACAGGCAGATG -3'
Posted On 2019-11-12