Incidental Mutation 'R7687:Zkscan2'
ID593150
Institutional Source Beutler Lab
Gene Symbol Zkscan2
Ensembl Gene ENSMUSG00000030757
Gene Namezinc finger with KRAB and SCAN domains 2
Synonyms9430065N20Rik, Zfp694
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location123475384-123500449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 123499862 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 36 (S36A)
Ref Sequence ENSEMBL: ENSMUSP00000041821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042470] [ENSMUST00000128217]
Predicted Effect probably benign
Transcript: ENSMUST00000042470
AA Change: S36A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041821
Gene: ENSMUSG00000030757
AA Change: S36A

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
KRAB 222 282 1.71e-2 SMART
SANT 333 397 3.73e0 SMART
low complexity region 449 469 N/A INTRINSIC
SANT 489 553 2.18e0 SMART
low complexity region 627 649 N/A INTRINSIC
ZnF_C2H2 768 790 6.42e-4 SMART
ZnF_C2H2 796 818 7.9e-4 SMART
ZnF_C2H2 824 846 5.99e-4 SMART
ZnF_C2H2 852 874 3.21e-4 SMART
ZnF_C2H2 880 902 1.18e-2 SMART
ZnF_C2H2 908 930 8.81e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128217
AA Change: S36A

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134381
Gene: ENSMUSG00000030757
AA Change: S36A

DomainStartEndE-ValueType
SCAN 41 148 1.62e-54 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Other mutations in Zkscan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zkscan2 APN 7 123479972 missense probably damaging 1.00
IGL02098:Zkscan2 APN 7 123499841 missense probably benign 0.02
IGL03093:Zkscan2 APN 7 123494850 missense probably benign 0.01
R0016:Zkscan2 UTSW 7 123499996 start gained probably benign
R0135:Zkscan2 UTSW 7 123480641 missense possibly damaging 0.63
R0541:Zkscan2 UTSW 7 123480200 missense possibly damaging 0.92
R0569:Zkscan2 UTSW 7 123498675 missense probably benign 0.11
R1537:Zkscan2 UTSW 7 123499841 missense possibly damaging 0.95
R1726:Zkscan2 UTSW 7 123489823 missense probably damaging 1.00
R3792:Zkscan2 UTSW 7 123485002 missense possibly damaging 0.95
R3802:Zkscan2 UTSW 7 123495142 intron probably benign
R3803:Zkscan2 UTSW 7 123495142 intron probably benign
R3804:Zkscan2 UTSW 7 123495142 intron probably benign
R4012:Zkscan2 UTSW 7 123498660 missense possibly damaging 0.76
R4111:Zkscan2 UTSW 7 123482684 intron probably benign
R4605:Zkscan2 UTSW 7 123498724 missense probably damaging 1.00
R4978:Zkscan2 UTSW 7 123495319 missense possibly damaging 0.86
R5004:Zkscan2 UTSW 7 123490044 missense probably damaging 1.00
R5163:Zkscan2 UTSW 7 123499867 missense probably benign 0.01
R5753:Zkscan2 UTSW 7 123480700 missense probably benign
R5830:Zkscan2 UTSW 7 123480100 missense possibly damaging 0.47
R6153:Zkscan2 UTSW 7 123489770 missense probably benign 0.06
R6912:Zkscan2 UTSW 7 123499973 start gained probably benign
R7170:Zkscan2 UTSW 7 123499807 missense possibly damaging 0.83
R7269:Zkscan2 UTSW 7 123489771 missense probably benign
R7310:Zkscan2 UTSW 7 123490053 missense possibly damaging 0.53
R7399:Zkscan2 UTSW 7 123480104 missense probably damaging 0.98
R7624:Zkscan2 UTSW 7 123498771 missense probably damaging 0.97
R8236:Zkscan2 UTSW 7 123479912 missense probably benign 0.01
R8443:Zkscan2 UTSW 7 123485428 missense probably damaging 1.00
Z1177:Zkscan2 UTSW 7 123480358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGTCTGAATCTTCTCAG -3'
(R):5'- GGTCCCATATTTCCAAGGGC -3'

Sequencing Primer
(F):5'- CTGAATCTTCTCAGGCAGAATGG -3'
(R):5'- GGTCCCATATTTCCAAGGGCATTAAG -3'
Posted On2019-11-12