Incidental Mutation 'R7687:Tnfrsf23'
ID593151
Institutional Source Beutler Lab
Gene Symbol Tnfrsf23
Ensembl Gene ENSMUSG00000037613
Gene Nametumor necrosis factor receptor superfamily, member 23
SynonymsmSOB, mDcTrailr1, Tnfrh1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location143665809-143685872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143681462 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 55 (S55L)
Ref Sequence ENSEMBL: ENSMUSP00000116742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035742] [ENSMUST00000152703] [ENSMUST00000208017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035742
AA Change: S55L

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042431
Gene: ENSMUSG00000037613
AA Change: S55L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 38 72 1.55e-1 SMART
TNFR 75 104 3.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152703
AA Change: S55L

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116742
Gene: ENSMUSG00000037613
AA Change: S55L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 38 72 1.55e-1 SMART
TNFR 75 114 1.29e-7 SMART
TNFR 116 155 2.14e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208017
AA Change: S55L

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the tumor necrosis factor superfamily of proteins. The encoded receptor has been shown to bind to the ligand TRAIL (tumor necrosis factor-related apoptosis-inducing ligand), but to have no signaling capacity. This gene shows elevated expression in mice with diet-induced fatty liver disease. This gene and other family members are present in a gene cluster on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Tnfrsf23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Tnfrsf23 APN 7 143679999 missense probably damaging 0.99
IGL02409:Tnfrsf23 APN 7 143668571 missense probably damaging 0.98
R1936:Tnfrsf23 UTSW 7 143668554 missense probably benign 0.04
R3840:Tnfrsf23 UTSW 7 143681529 missense probably benign 0.09
R4201:Tnfrsf23 UTSW 7 143670054 missense probably damaging 1.00
R4786:Tnfrsf23 UTSW 7 143680064 missense probably damaging 1.00
R4858:Tnfrsf23 UTSW 7 143681480 missense probably damaging 1.00
R5226:Tnfrsf23 UTSW 7 143685785 missense possibly damaging 0.68
R7759:Tnfrsf23 UTSW 7 143670835 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGTCTGTGTACCTTGGTTAG -3'
(R):5'- CAACTGCAGGCTTCAGAGTTC -3'

Sequencing Primer
(F):5'- AGGAAGCATCTCCTAGAGTTTG -3'
(R):5'- GGCTTCAGAGTTCTACAGCATAGC -3'
Posted On2019-11-12