Mutagenetix > Incidental Mutation

Incidental Mutation 'R7687:Tll1'

593153

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64014931-64206271 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 64121492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 109 (Y109*)

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000066166
AA Change: Y109*

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: Y109*

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,258,182	K2383R	probably benign	Het
Acly	C	T	11: 100,504,854		probably null	Het
Baiap3	T	A	17: 25,249,337	I276F	possibly damaging	Het
Cdc14b	A	T	13: 64,209,193	D419E	probably benign	Het
Celsr2	G	T	3: 108,397,769	P2165T	probably benign	Het
Clk4	A	G	11: 51,281,398	D476G	probably benign	Het
Dera	A	G	6: 137,836,880	T10A		Het
Dip2c	A	T	13: 9,604,581	T742S	probably benign	Het
Dohh	C	A	10: 81,387,806	A231E	probably benign	Het
Dot1l	T	G	10: 80,789,368	S1150A	possibly damaging	Het
Eea1	T	A	10: 96,026,598	I794N	probably benign	Het
En2	T	C	5: 28,170,289	S277P	probably damaging	Het
Erich1	A	G	8: 14,030,691	L276P	probably damaging	Het
Flnb	A	G	14: 7,924,224	N1779S	probably damaging	Het
Frzb	T	A	2: 80,424,635	T186S	probably benign	Het
Gdf7	T	A	12: 8,298,257	R347*	probably null	Het
Ighv9-4	T	C	12: 114,300,263	I17V	not run	Het
Ipo13	G	A	4: 117,911,891	P235S	probably benign	Het
Itga2	C	A	13: 114,866,260	G565C	probably damaging	Het
Kcnc4	CCCGCCGCCGCCGCCGCCGCCGC	CCCGCCGCCGCCGCCGCCGCCGCCGC	3: 107,458,609		probably benign	Het
Kcnk10	A	G	12: 98,435,096	I440T	probably damaging	Het
Kdm3a	T	A	6: 71,599,492	K779N	possibly damaging	Het
Kmt2d	C	T	15: 98,862,120	D1086N	unknown	Het
Kntc1	A	G	5: 123,759,089	I172V	probably benign	Het
Maip1	A	G	1: 57,411,844	E215G	probably damaging	Het
Mms19	A	T	19: 41,955,168	M417K	possibly damaging	Het
Mslnl	T	C	17: 25,743,183	V185A	probably damaging	Het
Naa11	A	T	5: 97,391,789	V170E	probably benign	Het
Ncapg	C	T	5: 45,699,885	P980S	probably benign	Het
Olfr170	T	C	16: 19,605,735	N310S	probably benign	Het
Pbxip1	A	G	3: 89,448,199	D675G	probably damaging	Het
Pdlim5	A	G	3: 142,277,847	S382P	probably benign	Het
Pkd1l1	T	A	11: 8,854,390	I2184F		Het
Plau	A	G	14: 20,839,798	Y237C	probably damaging	Het
Ppl	T	C	16: 5,097,942	T586A	probably benign	Het
Rapgef6	T	G	11: 54,661,075	I923S	possibly damaging	Het
Rbfox2	C	T	15: 77,306,494	G17D	unknown	Het
Sema3b	T	C	9: 107,603,814	D108G	probably damaging	Het
Slc6a20a	A	G	9: 123,656,266	I297T	probably damaging	Het
Slit1	A	G	19: 41,650,689	F261L	probably benign	Het
Tcp10a	T	A	17: 7,345,108	V433D	probably damaging	Het
Tktl2	A	G	8: 66,513,101	E437G	probably damaging	Het
Tmem79	A	G	3: 88,332,581	V274A	probably damaging	Het
Tnfrsf23	G	A	7: 143,681,462	S55L	probably benign	Het
Ubd	T	C	17: 37,193,974		probably null	Het
Ubl3	C	A	5: 148,506,175	R105L	possibly damaging	Het
Ubl7	A	T	9: 57,914,584	D72V	probably damaging	Het
Wdr55	T	C	18: 36,762,023	S81P	probably damaging	Het
Wtip	T	C	7: 34,116,619	Y344C	probably damaging	Het
Zfp488	A	G	14: 33,970,400	S269P	possibly damaging	Het
Zkscan2	A	C	7: 123,499,862	S36A	probably benign	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64016136	missense	probably benign
IGL00583:Tll1	APN	8	64205292	missense	probably benign
IGL00767:Tll1	APN	8	64071321	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64038454	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64070232	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64074289	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64016098	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64053967	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64017626	nonsense	probably null
IGL02469:Tll1	APN	8	64070280	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64070237	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64046997	splice site	probably benign
IGL02937:Tll1	APN	8	64205285	nonsense	probably null
IGL03006:Tll1	APN	8	64074217	splice site	probably benign
R0518:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64038452	splice site	probably null
R0612:Tll1	UTSW	8	64071310	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64074290	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64101950	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64038490	missense	probably benign
R1619:Tll1	UTSW	8	64056273	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64041442	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64117903	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64017686	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64085551	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64101873	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64025107	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64051401	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64070290	nonsense	probably null
R3032:Tll1	UTSW	8	64098492	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64053866	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64205224	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64118014	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64041511	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64056309	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64051377	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64085473	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64070199	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64093944	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64053949	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64093887	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64051493	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64101966	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64085488	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64117940	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64074263	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64041491	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64053891	nonsense	probably null
R6083:Tll1	UTSW	8	64038586	splice site	probably null
R6125:Tll1	UTSW	8	64051487	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64098534	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64051367	nonsense	probably null
R6508:Tll1	UTSW	8	64098460	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64041405	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64071281	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64098510	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64101881	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64124945	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64025188	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64025142	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64051357	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64098234	splice site	probably null
R7699:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64051449	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64025237	nonsense	probably null
R7954:Tll1	UTSW	8	64118534	missense	probably damaging	1.00
R8710:Tll1	UTSW	8	64124906	missense	possibly damaging	0.77
R8792:Tll1	UTSW	8	64085465	missense	probably damaging	1.00
R9134:Tll1	UTSW	8	64016167	missense	possibly damaging	0.91
R9444:Tll1	UTSW	8	64016089	missense	probably damaging	1.00
R9539:Tll1	UTSW	8	64041423	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64017628	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64047163	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTTCTCCAGCTGAAACG -3'
(R):5'- CTTTGCTCTCTATACAGATTCATGG -3'

Sequencing Primer
(F):5'- GCTGAAACGCTAAAAACTGTACATG -3'
(R):5'- CCAAGGTGAAATCAGCAGTA -3'

Posted On

2019-11-12