Incidental Mutation 'R7687:Ubl7'
ID 593155
Institutional Source Beutler Lab
Gene Symbol Ubl7
Ensembl Gene ENSMUSG00000055720
Gene Name ubiquitin-like 7 (bone marrow stromal cell-derived)
Synonyms 2300004C15Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 57818262-57837251 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57821867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 72 (D72V)
Ref Sequence ENSEMBL: ENSMUSP00000150925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163329] [ENSMUST00000213654] [ENSMUST00000214086] [ENSMUST00000216260] [ENSMUST00000216841] [ENSMUST00000216925] [ENSMUST00000217129] [ENSMUST00000217132] [ENSMUST00000217180]
AlphaFold Q91W67
Predicted Effect probably damaging
Transcript: ENSMUST00000163329
AA Change: D72V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126019
Gene: ENSMUSG00000055720
AA Change: D72V

DomainStartEndE-ValueType
UBQ 6 92 3.53e-5 SMART
low complexity region 206 221 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 270 293 N/A INTRINSIC
UBA 338 376 4.92e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213654
AA Change: D99V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000214086
Predicted Effect probably damaging
Transcript: ENSMUST00000216260
AA Change: D72V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216841
AA Change: D72V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216925
AA Change: D72V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217129
AA Change: D72V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217132
AA Change: D72V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217180
AA Change: D72V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Ubl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
breakdown UTSW 9 57,837,039 (GRCm39) missense probably damaging 1.00
vaticano UTSW 9 57,827,793 (GRCm39) missense probably damaging 1.00
R1457:Ubl7 UTSW 9 57,821,894 (GRCm39) missense probably damaging 1.00
R2102:Ubl7 UTSW 9 57,827,825 (GRCm39) missense probably damaging 1.00
R2679:Ubl7 UTSW 9 57,821,882 (GRCm39) missense probably damaging 0.98
R6277:Ubl7 UTSW 9 57,830,555 (GRCm39) missense possibly damaging 0.80
R6317:Ubl7 UTSW 9 57,818,456 (GRCm39) critical splice donor site probably null
R6436:Ubl7 UTSW 9 57,827,793 (GRCm39) missense probably damaging 1.00
R6768:Ubl7 UTSW 9 57,820,045 (GRCm39) missense probably benign 0.00
R7156:Ubl7 UTSW 9 57,837,039 (GRCm39) missense probably damaging 1.00
R7361:Ubl7 UTSW 9 57,821,905 (GRCm39) missense probably damaging 1.00
R7459:Ubl7 UTSW 9 57,821,875 (GRCm39) missense probably damaging 1.00
R7527:Ubl7 UTSW 9 57,820,167 (GRCm39) missense unknown
R7670:Ubl7 UTSW 9 57,837,052 (GRCm39) missense probably benign 0.00
R7831:Ubl7 UTSW 9 57,821,918 (GRCm39) missense possibly damaging 0.73
R8031:Ubl7 UTSW 9 57,830,489 (GRCm39) missense probably damaging 1.00
R9074:Ubl7 UTSW 9 57,826,637 (GRCm39) missense possibly damaging 0.55
R9098:Ubl7 UTSW 9 57,829,035 (GRCm39) missense probably benign 0.23
Z1176:Ubl7 UTSW 9 57,826,628 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGAGTGTACAGAAGTATGCAC -3'
(R):5'- GGACTGTATCCCAGGAACACAC -3'

Sequencing Primer
(F):5'- TTCAGCCACTGGTATTACAGGCG -3'
(R):5'- ACAAGCTCTTCCCTTGGAGATACTAG -3'
Posted On 2019-11-12