Incidental Mutation 'R7687:Sema3b'
ID 593156
Institutional Source Beutler Lab
Gene Symbol Sema3b
Ensembl Gene ENSMUSG00000057969
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Synonyms SemA, sema5, semaV, Semaa, LUCA-1, SemA
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 107597674-107609229 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107603814 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 108 (D108G)
Ref Sequence ENSEMBL: ENSMUSP00000073152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073448] [ENSMUST00000102529] [ENSMUST00000102530] [ENSMUST00000102531] [ENSMUST00000102532] [ENSMUST00000123926] [ENSMUST00000193180] [ENSMUST00000194433] [ENSMUST00000194606] [ENSMUST00000195057] [ENSMUST00000195662]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000073448
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073152
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102529
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099588
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102530
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099589
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102531
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099590
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102532
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099591
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123926
AA Change: D108G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137952
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193180
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141726
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 148 8.2e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194433
AA Change: D108G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141403
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 172 3.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194606
Predicted Effect probably benign
Transcript: ENSMUST00000195057
Predicted Effect probably damaging
Transcript: ENSMUST00000195662
AA Change: D108G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141614
Gene: ENSMUSG00000057969
AA Change: D108G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 137 8.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that belongs to the class 3 semaphorin/collapsin family. Members of this family play a role in growth cone guidance during neurogenesis. The encoded protein inhibits axonal extension. This protein is thought to be an osteoblast protein that regulates bone mass and affects skeletal homeostasis. A similar gene in humans functions as a tumor suppressor gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile with no obvious pathological abnormalities. Mice homozygous for a second knock-out allele exhibit improper positioning of a major brain commissural projection, the anterior commissure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Sema3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Sema3b APN 9 107604041 critical splice donor site probably null
IGL02750:Sema3b APN 9 107603164 missense probably benign 0.02
IGL02878:Sema3b APN 9 107600993 missense probably damaging 0.97
IGL03004:Sema3b APN 9 107602915 missense possibly damaging 0.72
IGL03026:Sema3b APN 9 107602063 missense probably damaging 1.00
IGL03129:Sema3b APN 9 107599796 unclassified probably benign
IGL03334:Sema3b APN 9 107604077 missense probably damaging 1.00
R0373:Sema3b UTSW 9 107602918 missense probably benign 0.05
R0384:Sema3b UTSW 9 107600966 missense probably damaging 1.00
R0883:Sema3b UTSW 9 107604156 missense possibly damaging 0.77
R3916:Sema3b UTSW 9 107600458 missense probably damaging 1.00
R3971:Sema3b UTSW 9 107600368 missense probably benign
R4212:Sema3b UTSW 9 107603398 missense probably damaging 1.00
R4647:Sema3b UTSW 9 107599051 missense possibly damaging 0.79
R4694:Sema3b UTSW 9 107605002 missense probably benign 0.03
R4791:Sema3b UTSW 9 107603813 missense probably damaging 1.00
R4853:Sema3b UTSW 9 107602067 splice site probably null
R5305:Sema3b UTSW 9 107603337 missense probably null 1.00
R5487:Sema3b UTSW 9 107600962 missense probably damaging 1.00
R5745:Sema3b UTSW 9 107601429 missense probably damaging 0.98
R5751:Sema3b UTSW 9 107599714 missense probably benign
R6086:Sema3b UTSW 9 107600848 missense probably damaging 1.00
R6306:Sema3b UTSW 9 107600920 missense possibly damaging 0.88
R6594:Sema3b UTSW 9 107598826 missense probably benign 0.01
R6816:Sema3b UTSW 9 107600350 missense probably benign 0.08
R6833:Sema3b UTSW 9 107603316 missense probably benign 0.04
R7320:Sema3b UTSW 9 107600942 missense probably benign
R7448:Sema3b UTSW 9 107602963 missense probably damaging 1.00
R8839:Sema3b UTSW 9 107601353 unclassified probably benign
R9090:Sema3b UTSW 9 107598955 missense probably damaging 1.00
R9123:Sema3b UTSW 9 107600974 missense possibly damaging 0.64
R9271:Sema3b UTSW 9 107598955 missense probably damaging 1.00
Z1088:Sema3b UTSW 9 107599034 splice site probably null
Z1176:Sema3b UTSW 9 107599639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACCTTCACAGGGTAACTACATGAG -3'
(R):5'- TAGGGTCCCAATCCAGTCTG -3'

Sequencing Primer
(F):5'- TCCCCCTGTGACTCAGAG -3'
(R):5'- GTCTAGACTCTAGAGAATCTCCAAGG -3'
Posted On 2019-11-12