Incidental Mutation 'R7687:Slc6a20a'
ID593157
Institutional Source Beutler Lab
Gene Symbol Slc6a20a
Ensembl Gene ENSMUSG00000036814
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20A
SynonymsXtrp3s1, A730081N20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location123634770-123678885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123656266 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 297 (I297T)
Ref Sequence ENSEMBL: ENSMUSP00000047690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040960] [ENSMUST00000170591] [ENSMUST00000171647]
Predicted Effect probably damaging
Transcript: ENSMUST00000040960
AA Change: I297T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047690
Gene: ENSMUSG00000036814
AA Change: I297T

DomainStartEndE-ValueType
Pfam:SNF 5 581 1.7e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170591
SMART Domains Protein: ENSMUSP00000132700
Gene: ENSMUSG00000036814

DomainStartEndE-ValueType
Pfam:SNF 1 37 5.1e-13 PFAM
Pfam:SNF 33 241 3.5e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171647
AA Change: I260T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129107
Gene: ENSMUSG00000036814
AA Change: I260T

DomainStartEndE-ValueType
Pfam:SNF 5 196 3.3e-72 PFAM
Pfam:SNF 194 544 8.4e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transport of small hydrophilic substances across cell membranes is mediated by substrate-specific transporter proteins which have been classified into several families of related genes. The protein encoded by this gene is a member of the subgroup of transporter with unidentified substrates within the Na+ and Cl- coupled transporter family. This gene is expressed in kidney, and its alternative splicing generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Slc6a20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Slc6a20a APN 9 123660619 missense possibly damaging 0.95
eyeful UTSW 9 123637070 missense probably damaging 1.00
R0115:Slc6a20a UTSW 9 123678758 missense possibly damaging 0.84
R0255:Slc6a20a UTSW 9 123664621 missense probably damaging 1.00
R0512:Slc6a20a UTSW 9 123660406 missense probably damaging 1.00
R1744:Slc6a20a UTSW 9 123662993 missense probably benign 0.01
R1751:Slc6a20a UTSW 9 123637100 missense probably damaging 1.00
R1767:Slc6a20a UTSW 9 123637100 missense probably damaging 1.00
R1908:Slc6a20a UTSW 9 123656308 missense probably damaging 1.00
R1983:Slc6a20a UTSW 9 123640587 missense probably damaging 1.00
R2391:Slc6a20a UTSW 9 123664621 missense probably damaging 1.00
R3107:Slc6a20a UTSW 9 123641708 critical splice donor site probably null
R3547:Slc6a20a UTSW 9 123660502 missense probably damaging 1.00
R3760:Slc6a20a UTSW 9 123662989 missense probably damaging 0.99
R4126:Slc6a20a UTSW 9 123660533 missense probably damaging 1.00
R5584:Slc6a20a UTSW 9 123640688 missense probably damaging 1.00
R5881:Slc6a20a UTSW 9 123641708 critical splice donor site probably null
R6749:Slc6a20a UTSW 9 123637070 missense probably damaging 1.00
R7447:Slc6a20a UTSW 9 123656224 missense possibly damaging 0.47
R8017:Slc6a20a UTSW 9 123637852 missense probably damaging 1.00
R8017:Slc6a20a UTSW 9 123664574 missense probably damaging 1.00
R8019:Slc6a20a UTSW 9 123637852 missense probably damaging 1.00
R8019:Slc6a20a UTSW 9 123664574 missense probably damaging 1.00
R8023:Slc6a20a UTSW 9 123660592 missense probably damaging 1.00
R8145:Slc6a20a UTSW 9 123637000 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTAGCTCCCAACAGTGG -3'
(R):5'- CCTACTGGCCTTCTAGATGGAAC -3'

Sequencing Primer
(F):5'- TTTCAGCTCAGAGCTCTG -3'
(R):5'- TGGAACAGCTAGCCAACCC -3'
Posted On2019-11-12