Incidental Mutation 'R7687:Dohh'
ID593159
Institutional Source Beutler Lab
Gene Symbol Dohh
Ensembl Gene ENSMUSG00000078440
Gene Namedeoxyhypusine hydroxylase/monooxygenase
Synonyms1110033C18Rik, Hlrc1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location81384428-81388352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81387806 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 231 (A231E)
Ref Sequence ENSEMBL: ENSMUSP00000072534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072751] [ENSMUST00000121047] [ENSMUST00000125635] [ENSMUST00000134592] [ENSMUST00000142346] [ENSMUST00000144647] [ENSMUST00000156229]
Predicted Effect probably benign
Transcript: ENSMUST00000072751
AA Change: A231E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072534
Gene: ENSMUSG00000078440
AA Change: A231E

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
EZ_HEAT 173 202 6.64e-4 SMART
EZ_HEAT 204 233 4.31e-3 SMART
EZ_HEAT 237 266 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121047
SMART Domains Protein: ENSMUSP00000113112
Gene: ENSMUSG00000078440

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
EZ_HEAT 173 202 4.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125635
Predicted Effect
SMART Domains Protein: ENSMUSP00000115416
Gene: ENSMUSG00000113262
AA Change: A88E

DomainStartEndE-ValueType
EZ_HEAT 31 60 6.64e-4 SMART
EZ_HEAT 62 91 4.31e-3 SMART
EZ_HEAT 95 124 2e-7 SMART
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134592
SMART Domains Protein: ENSMUSP00000120386
Gene: ENSMUSG00000078440

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 74 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142346
SMART Domains Protein: ENSMUSP00000122952
Gene: ENSMUSG00000078440

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
internal_repeat_1 156 188 1.17e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144647
SMART Domains Protein: ENSMUSP00000116074
Gene: ENSMUSG00000113262

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
EZ_HEAT 173 199 1.34e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156229
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metalloenzyme that catalyzes the last step in the conversion of lysine to the unique amino acid hypusine in eukaryotic initiation factor 5A. The encoded protein hydroxylates deoxyhypusine to form hypusine in the mature eukaryotic initiation factor 5A protein. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null mutation die prior to organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Dohh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Dohh APN 10 81387922 splice site probably null
R0331:Dohh UTSW 10 81387812 missense probably benign 0.03
R5243:Dohh UTSW 10 81387369 missense probably benign 0.00
R7209:Dohh UTSW 10 81386040 missense probably damaging 1.00
R7980:Dohh UTSW 10 81387892 nonsense probably null
R8271:Dohh UTSW 10 81386010 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTTTACCTGGCTGCCTAAC -3'
(R):5'- ATACTGGAAATCCTGGCTGC -3'

Sequencing Primer
(F):5'- ACCTGGCTGCCTAACCATAGTG -3'
(R):5'- GGAAATCCTGGCTGCTCTCATAC -3'
Posted On2019-11-12