Incidental Mutation 'R7687:Eea1'
ID593160
Institutional Source Beutler Lab
Gene Symbol Eea1
Ensembl Gene ENSMUSG00000036499
Gene Nameearly endosome antigen 1
SynonymsZFYVE2, B230358H09Rik, A430109M19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R7687 (G1)
Quality Score206.009
Status Not validated
Chromosome10
Chromosomal Location95940650-96045518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96026598 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 794 (I794N)
Ref Sequence ENSEMBL: ENSMUSP00000061493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053484] [ENSMUST00000218291]
Predicted Effect probably benign
Transcript: ENSMUST00000053484
AA Change: I794N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061493
Gene: ENSMUSG00000036499
AA Change: I794N

DomainStartEndE-ValueType
ZnF_C2H2 41 64 2.2e-2 SMART
low complexity region 98 123 N/A INTRINSIC
low complexity region 135 148 N/A INTRINSIC
low complexity region 389 408 N/A INTRINSIC
low complexity region 480 500 N/A INTRINSIC
low complexity region 573 585 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 748 760 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 947 958 N/A INTRINSIC
low complexity region 996 1010 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1198 1217 N/A INTRINSIC
FYVE 1344 1411 1.99e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218291
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Eea1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Eea1 APN 10 96031677 missense probably damaging 0.99
IGL01645:Eea1 APN 10 95989589 missense probably damaging 1.00
IGL01646:Eea1 APN 10 95997015 missense probably damaging 0.99
IGL01870:Eea1 APN 10 95973986 missense probably damaging 1.00
IGL02074:Eea1 APN 10 96037487 missense probably damaging 1.00
IGL02229:Eea1 APN 10 96018184 missense probably damaging 1.00
IGL02885:Eea1 APN 10 96041484 missense probably benign 0.04
IGL02971:Eea1 APN 10 96041527 missense probably benign 0.37
IGL03223:Eea1 APN 10 96039611 missense probably damaging 1.00
IGL03355:Eea1 APN 10 96042212 utr 3 prime probably benign
Senior UTSW 10 96011037 missense probably benign
Slump UTSW 10 96036633 missense probably benign 0.00
R0189:Eea1 UTSW 10 95995582 missense possibly damaging 0.86
R0374:Eea1 UTSW 10 96039772 splice site probably benign
R0655:Eea1 UTSW 10 95995598 missense probably benign 0.00
R0883:Eea1 UTSW 10 96021667 missense possibly damaging 0.63
R1219:Eea1 UTSW 10 96010761 splice site probably benign
R1344:Eea1 UTSW 10 95994999 critical splice donor site probably null
R1768:Eea1 UTSW 10 95996960 missense probably damaging 1.00
R1887:Eea1 UTSW 10 96018211 critical splice donor site probably null
R2224:Eea1 UTSW 10 96020012 missense probably damaging 0.99
R2927:Eea1 UTSW 10 96013358 missense probably benign 0.00
R3922:Eea1 UTSW 10 96036633 missense probably benign 0.00
R3950:Eea1 UTSW 10 96042134 missense probably damaging 1.00
R4502:Eea1 UTSW 10 96039565 missense probably benign 0.14
R4647:Eea1 UTSW 10 96028393 missense probably benign
R4876:Eea1 UTSW 10 95995613 missense probably benign 0.07
R5009:Eea1 UTSW 10 96011021 missense probably benign
R5018:Eea1 UTSW 10 96011037 missense probably benign
R5490:Eea1 UTSW 10 96026054 missense probably benign 0.41
R5588:Eea1 UTSW 10 96023910 missense probably benign 0.01
R5791:Eea1 UTSW 10 96019995 missense probably benign 0.24
R5799:Eea1 UTSW 10 96002948 missense possibly damaging 0.81
R5842:Eea1 UTSW 10 96018124 missense probably damaging 1.00
R6332:Eea1 UTSW 10 96041473 missense possibly damaging 0.79
R6376:Eea1 UTSW 10 96038798 missense probably benign 0.01
R6468:Eea1 UTSW 10 96028412 missense probably benign 0.14
R6740:Eea1 UTSW 10 96023993 missense probably benign
R6889:Eea1 UTSW 10 96037478 missense probably benign 0.14
R6904:Eea1 UTSW 10 96002879 splice site probably null
R7269:Eea1 UTSW 10 96018138 missense probably damaging 1.00
R7273:Eea1 UTSW 10 95989631 missense probably benign 0.00
R7398:Eea1 UTSW 10 95995631 missense probably benign
R7400:Eea1 UTSW 10 95995570 missense probably benign 0.02
R7537:Eea1 UTSW 10 95994905 nonsense probably null
R7762:Eea1 UTSW 10 96028439 missense probably benign 0.10
R8097:Eea1 UTSW 10 96026654 missense probably benign 0.01
R8114:Eea1 UTSW 10 95994989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCGCGTGCATCTAATGAG -3'
(R):5'- TGTTGTAGAAAGCTCGGCC -3'

Sequencing Primer
(F):5'- GAGATGTCTTAAGGCAAATTTCAGTG -3'
(R):5'- AAAGCTCGGCCAGGAGTGC -3'
Posted On2019-11-12