Incidental Mutation 'R7687:Pkd1l1'
ID 593161
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Name polycystic kidney disease 1 like 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 8782025-8924365 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8804390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2184 (I2184F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178195]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: I2184F

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178195
AA Change: I1734F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136518
Gene: ENSMUSG00000046634
AA Change: I1734F

DomainStartEndE-ValueType
Pfam:REJ 3 552 3.3e-41 PFAM
low complexity region 757 767 N/A INTRINSIC
Blast:GPS 919 965 2e-13 BLAST
transmembrane domain 983 1000 N/A INTRINSIC
Pfam:PLAT 1030 1145 7.2e-14 PFAM
transmembrane domain 1189 1208 N/A INTRINSIC
transmembrane domain 1228 1250 N/A INTRINSIC
transmembrane domain 1366 1388 N/A INTRINSIC
transmembrane domain 1403 1425 N/A INTRINSIC
Pfam:PKD_channel 1658 1889 2e-25 PFAM
transmembrane domain 1930 1952 N/A INTRINSIC
low complexity region 1985 1998 N/A INTRINSIC
low complexity region 2007 2018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8,911,971 (GRCm39) missense unknown
IGL00156:Pkd1l1 APN 11 8,900,515 (GRCm39) missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8,879,353 (GRCm39) critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8,784,773 (GRCm39) critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8,818,493 (GRCm39) missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8,794,585 (GRCm39) missense probably benign
IGL01071:Pkd1l1 APN 11 8,798,921 (GRCm39) missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8,851,345 (GRCm39) missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8,883,685 (GRCm39) missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8,851,174 (GRCm39) missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8,900,409 (GRCm39) missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8,911,336 (GRCm39) missense unknown
IGL01999:Pkd1l1 APN 11 8,786,291 (GRCm39) missense probably benign
IGL02080:Pkd1l1 APN 11 8,911,345 (GRCm39) missense unknown
IGL02106:Pkd1l1 APN 11 8,783,800 (GRCm39) missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8,784,897 (GRCm39) missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8,852,467 (GRCm39) missense probably benign
IGL02337:Pkd1l1 APN 11 8,892,079 (GRCm39) missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8,794,560 (GRCm39) missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8,784,910 (GRCm39) missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8,852,582 (GRCm39) missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8,818,450 (GRCm39) splice site probably benign
IGL02972:Pkd1l1 APN 11 8,813,908 (GRCm39) missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8,805,564 (GRCm39) missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8,784,793 (GRCm39) missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8,915,127 (GRCm39) missense unknown
PIT4581001:Pkd1l1 UTSW 11 8,866,298 (GRCm39) frame shift probably null
R0020:Pkd1l1 UTSW 11 8,825,765 (GRCm39) splice site probably benign
R0020:Pkd1l1 UTSW 11 8,825,765 (GRCm39) splice site probably benign
R0496:Pkd1l1 UTSW 11 8,879,430 (GRCm39) missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8,786,448 (GRCm39) splice site probably benign
R0582:Pkd1l1 UTSW 11 8,881,699 (GRCm39) splice site probably benign
R0761:Pkd1l1 UTSW 11 8,804,375 (GRCm39) missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8,886,898 (GRCm39) missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8,784,806 (GRCm39) missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8,891,038 (GRCm39) splice site probably benign
R1401:Pkd1l1 UTSW 11 8,804,487 (GRCm39) nonsense probably null
R1444:Pkd1l1 UTSW 11 8,804,386 (GRCm39) missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8,820,313 (GRCm39) missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8,866,302 (GRCm39) missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8,891,077 (GRCm39) missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8,824,179 (GRCm39) missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8,851,200 (GRCm39) missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8,900,413 (GRCm39) missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8,794,670 (GRCm39) splice site probably benign
R1929:Pkd1l1 UTSW 11 8,786,197 (GRCm39) splice site probably benign
R1958:Pkd1l1 UTSW 11 8,824,161 (GRCm39) missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8,900,422 (GRCm39) missense probably benign
R2223:Pkd1l1 UTSW 11 8,839,063 (GRCm39) missense probably benign 0.18
R2264:Pkd1l1 UTSW 11 8,829,112 (GRCm39) missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8,776,819 (GRCm39) splice site probably null
R2431:Pkd1l1 UTSW 11 8,897,197 (GRCm39) missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8,912,701 (GRCm39) missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8,908,900 (GRCm39) missense unknown
R2888:Pkd1l1 UTSW 11 8,897,251 (GRCm39) missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8,824,236 (GRCm39) missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8,923,021 (GRCm39) missense unknown
R3153:Pkd1l1 UTSW 11 8,817,207 (GRCm39) missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8,839,050 (GRCm39) missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8,915,047 (GRCm39) critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8,911,983 (GRCm39) missense unknown
R3970:Pkd1l1 UTSW 11 8,824,218 (GRCm39) missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8,859,929 (GRCm39) missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8,859,929 (GRCm39) missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8,815,543 (GRCm39) missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8,815,543 (GRCm39) missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8,815,543 (GRCm39) missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8,815,543 (GRCm39) missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8,851,253 (GRCm39) missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8,908,964 (GRCm39) missense unknown
R4797:Pkd1l1 UTSW 11 8,911,340 (GRCm39) missense unknown
R4910:Pkd1l1 UTSW 11 8,879,360 (GRCm39) missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8,794,585 (GRCm39) missense probably benign
R5084:Pkd1l1 UTSW 11 8,892,004 (GRCm39) missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8,799,003 (GRCm39) missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8,829,204 (GRCm39) missense probably benign
R5483:Pkd1l1 UTSW 11 8,851,141 (GRCm39) critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8,783,877 (GRCm39) missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8,829,202 (GRCm39) missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8,859,889 (GRCm39) missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8,817,204 (GRCm39) missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8,866,301 (GRCm39) missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8,811,302 (GRCm39) missense probably benign
R5874:Pkd1l1 UTSW 11 8,858,688 (GRCm39) missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8,829,176 (GRCm39) missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8,813,849 (GRCm39) missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8,908,969 (GRCm39) missense unknown
R6000:Pkd1l1 UTSW 11 8,900,427 (GRCm39) missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8,807,113 (GRCm39) missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8,819,452 (GRCm39) splice site probably null
R6027:Pkd1l1 UTSW 11 8,866,272 (GRCm39) nonsense probably null
R6028:Pkd1l1 UTSW 11 8,786,267 (GRCm39) missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8,818,543 (GRCm39) missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8,815,555 (GRCm39) missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8,851,287 (GRCm39) missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8,892,195 (GRCm39) missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8,794,649 (GRCm39) missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8,813,911 (GRCm39) missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8,839,052 (GRCm39) missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8,923,217 (GRCm39) missense unknown
R6987:Pkd1l1 UTSW 11 8,852,575 (GRCm39) missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8,799,046 (GRCm39) missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8,840,737 (GRCm39) missense
R7224:Pkd1l1 UTSW 11 8,895,241 (GRCm39) missense
R7244:Pkd1l1 UTSW 11 8,821,771 (GRCm39) missense
R7265:Pkd1l1 UTSW 11 8,879,402 (GRCm39) missense
R7358:Pkd1l1 UTSW 11 8,895,202 (GRCm39) missense
R7387:Pkd1l1 UTSW 11 8,851,203 (GRCm39) missense
R7414:Pkd1l1 UTSW 11 8,866,267 (GRCm39) missense
R7459:Pkd1l1 UTSW 11 8,852,428 (GRCm39) missense
R7478:Pkd1l1 UTSW 11 8,879,441 (GRCm39) missense
R7485:Pkd1l1 UTSW 11 8,915,148 (GRCm39) missense
R7490:Pkd1l1 UTSW 11 8,866,265 (GRCm39) missense
R7644:Pkd1l1 UTSW 11 8,825,758 (GRCm39) missense
R7647:Pkd1l1 UTSW 11 8,897,296 (GRCm39) missense
R7676:Pkd1l1 UTSW 11 8,912,708 (GRCm39) missense
R7699:Pkd1l1 UTSW 11 8,915,142 (GRCm39) missense
R7922:Pkd1l1 UTSW 11 8,859,857 (GRCm39) missense
R7922:Pkd1l1 UTSW 11 8,799,013 (GRCm39) missense
R7980:Pkd1l1 UTSW 11 8,804,375 (GRCm39) missense probably damaging 1.00
R7993:Pkd1l1 UTSW 11 8,895,262 (GRCm39) missense
R8052:Pkd1l1 UTSW 11 8,897,315 (GRCm39) missense
R8125:Pkd1l1 UTSW 11 8,897,241 (GRCm39) missense probably damaging 1.00
R8420:Pkd1l1 UTSW 11 8,820,277 (GRCm39) nonsense probably null
R8675:Pkd1l1 UTSW 11 8,798,916 (GRCm39) critical splice donor site probably null
R8683:Pkd1l1 UTSW 11 8,821,805 (GRCm39) missense
R8709:Pkd1l1 UTSW 11 8,805,567 (GRCm39) missense
R8711:Pkd1l1 UTSW 11 8,815,550 (GRCm39) missense
R8725:Pkd1l1 UTSW 11 8,911,482 (GRCm39) missense
R8733:Pkd1l1 UTSW 11 8,883,657 (GRCm39) missense
R8822:Pkd1l1 UTSW 11 8,806,312 (GRCm39) missense
R8871:Pkd1l1 UTSW 11 8,900,503 (GRCm39) missense
R9009:Pkd1l1 UTSW 11 8,881,552 (GRCm39) missense
R9099:Pkd1l1 UTSW 11 8,922,986 (GRCm39) missense
R9119:Pkd1l1 UTSW 11 8,829,107 (GRCm39) missense
R9150:Pkd1l1 UTSW 11 8,786,256 (GRCm39) missense
R9314:Pkd1l1 UTSW 11 8,829,153 (GRCm39) missense
R9341:Pkd1l1 UTSW 11 8,911,305 (GRCm39) missense
R9341:Pkd1l1 UTSW 11 8,786,399 (GRCm39) missense
R9343:Pkd1l1 UTSW 11 8,911,305 (GRCm39) missense
R9343:Pkd1l1 UTSW 11 8,786,399 (GRCm39) missense
R9392:Pkd1l1 UTSW 11 8,794,567 (GRCm39) missense
R9424:Pkd1l1 UTSW 11 8,820,091 (GRCm39) missense
R9496:Pkd1l1 UTSW 11 8,783,773 (GRCm39) critical splice donor site probably null
R9504:Pkd1l1 UTSW 11 8,815,631 (GRCm39) missense
R9563:Pkd1l1 UTSW 11 8,815,502 (GRCm39) missense
R9570:Pkd1l1 UTSW 11 8,840,697 (GRCm39) missense
R9585:Pkd1l1 UTSW 11 8,804,390 (GRCm39) missense
R9618:Pkd1l1 UTSW 11 8,911,420 (GRCm39) missense
R9709:Pkd1l1 UTSW 11 8,799,016 (GRCm39) missense probably damaging 0.98
R9741:Pkd1l1 UTSW 11 8,897,224 (GRCm39) missense
R9801:Pkd1l1 UTSW 11 8,908,964 (GRCm39) nonsense probably null
X0024:Pkd1l1 UTSW 11 8,900,413 (GRCm39) missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8,879,430 (GRCm39) missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8,859,921 (GRCm39) missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8,776,801 (GRCm39) missense
Z1177:Pkd1l1 UTSW 11 8,895,208 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GATTCATGCCTCATAAAAGCGGC -3'
(R):5'- CTGAACCTGGGATGCTTTCC -3'

Sequencing Primer
(F):5'- CCTCATAAAAGCGGCAAAAGAATTG -3'
(R):5'- GGATGCTTTCCAGACATGAAGCC -3'
Posted On 2019-11-12