Incidental Mutation 'R7687:Gdf7'
ID 593165
Institutional Source Beutler Lab
Gene Symbol Gdf7
Ensembl Gene ENSMUSG00000037660
Gene Name growth differentiation factor 7
Synonyms BMP12
Accession Numbers
Essential gene? Probably essential (E-score: 0.793) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 8347918-8351954 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 8348257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 347 (R347*)
Ref Sequence ENSEMBL: ENSMUSP00000151234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037313] [ENSMUST00000220073]
AlphaFold P43029
Predicted Effect probably null
Transcript: ENSMUST00000037313
AA Change: R355*
SMART Domains Protein: ENSMUSP00000038301
Gene: ENSMUSG00000037660
AA Change: R355*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TGFb_propeptide 49 275 2.3e-15 PFAM
low complexity region 281 302 N/A INTRINSIC
low complexity region 308 357 N/A INTRINSIC
TGFB 360 461 1.14e-63 SMART
Predicted Effect probably null
Transcript: ENSMUST00000220073
AA Change: R347*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein may play a role in the differentiation of tendon cells and spinal cord interneurons. Mice lacking a functional copy of this gene exhibit absence of some spinal dopaminergic neurons and brain defects, male sterility, and premature death. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele lack D1A neurons in the dorsal spinal cord; some develop severe hydrocephaly with dilated ventricles and late-onset brain defects. Mice homozygous for another null allele show premature death, hydrocephaly, aberrant seminal vesicle development and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Gdf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02796:Gdf7 UTSW 12 8,351,666 (GRCm39) missense unknown
R0781:Gdf7 UTSW 12 8,351,555 (GRCm39) splice site probably benign
R1457:Gdf7 UTSW 12 8,348,073 (GRCm39) missense probably damaging 0.97
R1556:Gdf7 UTSW 12 8,351,698 (GRCm39) missense unknown
R1643:Gdf7 UTSW 12 8,347,971 (GRCm39) missense probably damaging 1.00
R2010:Gdf7 UTSW 12 8,351,729 (GRCm39) missense unknown
R2439:Gdf7 UTSW 12 8,348,050 (GRCm39) missense probably damaging 1.00
R2899:Gdf7 UTSW 12 8,348,470 (GRCm39) missense unknown
R3894:Gdf7 UTSW 12 8,348,845 (GRCm39) missense unknown
R4854:Gdf7 UTSW 12 8,348,014 (GRCm39) missense probably damaging 0.99
R5207:Gdf7 UTSW 12 8,348,371 (GRCm39) missense unknown
R6199:Gdf7 UTSW 12 8,348,832 (GRCm39) missense unknown
R6583:Gdf7 UTSW 12 8,351,758 (GRCm39) missense unknown
R7745:Gdf7 UTSW 12 8,351,854 (GRCm39) missense unknown
R8705:Gdf7 UTSW 12 8,348,167 (GRCm39) missense probably damaging 0.96
R8845:Gdf7 UTSW 12 8,348,905 (GRCm39) missense unknown
R9100:Gdf7 UTSW 12 8,348,652 (GRCm39) missense unknown
Z1176:Gdf7 UTSW 12 8,348,578 (GRCm39) missense unknown
Z1176:Gdf7 UTSW 12 8,348,409 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGCAGCGTCTGAATGATGGC -3'
(R):5'- AGAGAGTCTGTTCCGGGAGATC -3'

Sequencing Primer
(F):5'- CGTGGTTGGTAGGCTCCAG -3'
(R):5'- ACCGGATCCAGGACCAG -3'
Posted On 2019-11-12