Incidental Mutation 'R7687:Kcnk10'
ID 593166
Institutional Source Beutler Lab
Gene Symbol Kcnk10
Ensembl Gene ENSMUSG00000033854
Gene Name potassium channel, subfamily K, member 10
Synonyms Trek2, 3010005K24Rik, 1700024D23Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98395691-98544472 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98401355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 440 (I440T)
Ref Sequence ENSEMBL: ENSMUSP00000152473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110113] [ENSMUST00000221240]
AlphaFold Q8BUW1
Predicted Effect probably damaging
Transcript: ENSMUST00000110113
AA Change: I426T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105740
Gene: ENSMUSG00000033854
AA Change: I426T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ion_trans 55 207 9.3e-8 PFAM
Pfam:Ion_trans_2 126 204 3.3e-20 PFAM
Pfam:Ion_trans_2 223 321 8.5e-21 PFAM
low complexity region 449 462 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221240
AA Change: I440T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations, and is stimulated strongly by arachidonic acid and to a lesser degree by membrane stretching, intracellular acidification, and general anaesthetics. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal glucose hyperpolarization of hypothalamic neurons in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Kcnk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Kcnk10 APN 12 98,484,792 (GRCm39) missense probably damaging 0.99
IGL01409:Kcnk10 APN 12 98,456,322 (GRCm39) missense probably damaging 1.00
IGL02149:Kcnk10 APN 12 98,485,099 (GRCm39) splice site probably benign
R0467:Kcnk10 UTSW 12 98,456,204 (GRCm39) missense probably benign 0.43
R0558:Kcnk10 UTSW 12 98,402,560 (GRCm39) missense possibly damaging 0.89
R0665:Kcnk10 UTSW 12 98,406,944 (GRCm39) missense probably benign 0.00
R1033:Kcnk10 UTSW 12 98,484,929 (GRCm39) missense possibly damaging 0.93
R1036:Kcnk10 UTSW 12 98,462,445 (GRCm39) splice site probably benign
R1398:Kcnk10 UTSW 12 98,402,485 (GRCm39) missense probably damaging 0.99
R1482:Kcnk10 UTSW 12 98,456,207 (GRCm39) missense probably damaging 0.99
R1675:Kcnk10 UTSW 12 98,462,547 (GRCm39) missense probably benign 0.31
R2858:Kcnk10 UTSW 12 98,401,548 (GRCm39) missense possibly damaging 0.64
R2871:Kcnk10 UTSW 12 98,401,072 (GRCm39) missense probably benign 0.41
R2871:Kcnk10 UTSW 12 98,401,072 (GRCm39) missense probably benign 0.41
R3736:Kcnk10 UTSW 12 98,456,171 (GRCm39) missense probably benign 0.31
R3845:Kcnk10 UTSW 12 98,407,003 (GRCm39) missense probably benign 0.11
R4077:Kcnk10 UTSW 12 98,401,205 (GRCm39) missense probably benign 0.03
R4541:Kcnk10 UTSW 12 98,402,536 (GRCm39) missense probably damaging 1.00
R4605:Kcnk10 UTSW 12 98,456,219 (GRCm39) missense probably damaging 1.00
R4841:Kcnk10 UTSW 12 98,401,175 (GRCm39) missense probably benign 0.00
R4842:Kcnk10 UTSW 12 98,401,175 (GRCm39) missense probably benign 0.00
R4886:Kcnk10 UTSW 12 98,401,418 (GRCm39) missense possibly damaging 0.89
R4968:Kcnk10 UTSW 12 98,401,161 (GRCm39) missense probably benign 0.01
R4977:Kcnk10 UTSW 12 98,406,946 (GRCm39) missense probably benign 0.07
R5108:Kcnk10 UTSW 12 98,401,560 (GRCm39) missense probably benign 0.39
R5166:Kcnk10 UTSW 12 98,401,254 (GRCm39) missense probably damaging 0.98
R5936:Kcnk10 UTSW 12 98,456,191 (GRCm39) missense probably benign 0.12
R6193:Kcnk10 UTSW 12 98,407,031 (GRCm39) missense probably benign 0.07
R7107:Kcnk10 UTSW 12 98,485,002 (GRCm39) nonsense probably null
R7611:Kcnk10 UTSW 12 98,484,899 (GRCm39) missense probably damaging 1.00
R8225:Kcnk10 UTSW 12 98,406,849 (GRCm39) critical splice donor site probably null
R8270:Kcnk10 UTSW 12 98,401,358 (GRCm39) missense
R9040:Kcnk10 UTSW 12 98,401,098 (GRCm39) missense probably benign 0.00
R9094:Kcnk10 UTSW 12 98,484,775 (GRCm39) missense probably benign 0.01
X0067:Kcnk10 UTSW 12 98,485,083 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATACACTCTGTCAGCATGGC -3'
(R):5'- CTATCCGAAGTATGGAGCGC -3'

Sequencing Primer
(F):5'- GCATGGCTGTGCTGGAG -3'
(R):5'- TGGGCTTGGACCAGAGG -3'
Posted On 2019-11-12