Incidental Mutation 'R7687:Cdc14b'
ID593169
Institutional Source Beutler Lab
Gene Symbol Cdc14b
Ensembl Gene ENSMUSG00000033102
Gene NameCDC14 cell division cycle 14B
SynonymsA530086E13Rik, 2810432N10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location64189268-64275290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64209193 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 419 (D419E)
Ref Sequence ENSEMBL: ENSMUSP00000152388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039318] [ENSMUST00000109769] [ENSMUST00000109770] [ENSMUST00000221139] [ENSMUST00000221634] [ENSMUST00000222766]
Predicted Effect probably damaging
Transcript: ENSMUST00000039318
AA Change: D419E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046003
Gene: ENSMUSG00000033102
AA Change: D419E

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 6.1e-57 PFAM
Pfam:DSPc 240 365 9.2e-17 PFAM
Pfam:Y_phosphatase 244 365 1e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109769
AA Change: D382E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105391
Gene: ENSMUSG00000033102
AA Change: D382E

DomainStartEndE-ValueType
Pfam:DSPn 12 152 2.5e-58 PFAM
Pfam:DSPc 203 328 8e-17 PFAM
Pfam:Y_phosphatase 206 328 8.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109770
AA Change: D419E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105392
Gene: ENSMUSG00000033102
AA Change: D419E

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
Pfam:DSPn 51 189 3.4e-57 PFAM
Pfam:DSPc 240 365 2.8e-16 PFAM
Pfam:Y_phosphatase 252 364 2.4e-7 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221139
AA Change: D419E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000221217
Predicted Effect probably benign
Transcript: ENSMUST00000221634
AA Change: D419E

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222713
AA Change: D78E

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222766
AA Change: D23E

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. This protein is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, which suggests the role in cell cycle control. This protein has been shown to interact with and dephosphorylates tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splice of this gene results in 3 transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature aging, including premature cataracts and kyphosis; reduced fertility, particularly in female mice; and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Cdc14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cdc14b APN 13 64215656 missense probably damaging 1.00
IGL00816:Cdc14b APN 13 64205403 missense probably benign 0.10
IGL02569:Cdc14b APN 13 64225614 missense probably benign 0.36
IGL02634:Cdc14b APN 13 64216303 splice site probably benign
IGL02897:Cdc14b APN 13 64247253 missense probably benign 0.00
R0390:Cdc14b UTSW 13 64210192 unclassified probably benign
R0542:Cdc14b UTSW 13 64243683 missense probably benign 0.01
R1022:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1024:Cdc14b UTSW 13 64215676 missense probably damaging 1.00
R1676:Cdc14b UTSW 13 64225602 missense possibly damaging 0.93
R1945:Cdc14b UTSW 13 64219890 missense probably damaging 1.00
R1964:Cdc14b UTSW 13 64215537 missense probably damaging 1.00
R3162:Cdc14b UTSW 13 64246608 splice site probably benign
R4359:Cdc14b UTSW 13 64248411 missense probably benign 0.27
R4598:Cdc14b UTSW 13 64247274 missense probably benign
R4716:Cdc14b UTSW 13 64209200 missense probably damaging 1.00
R6196:Cdc14b UTSW 13 64205524 intron probably benign
R6219:Cdc14b UTSW 13 64205524 intron probably benign
R6361:Cdc14b UTSW 13 64216209 splice site probably null
R6480:Cdc14b UTSW 13 64225650 critical splice acceptor site probably null
R6565:Cdc14b UTSW 13 64225630 missense probably benign 0.01
R6692:Cdc14b UTSW 13 64215563 missense probably damaging 0.98
R7204:Cdc14b UTSW 13 64210198 missense possibly damaging 0.83
R7327:Cdc14b UTSW 13 64225647 missense probably damaging 1.00
R7464:Cdc14b UTSW 13 64196675 nonsense probably null
R7639:Cdc14b UTSW 13 64205329 missense possibly damaging 0.96
R8170:Cdc14b UTSW 13 64215735 splice site probably null
Z1176:Cdc14b UTSW 13 64274669 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGCAGAGCACCTCTAGATTTTAAAC -3'
(R):5'- AAACTGCCGCTTAGCATTCAG -3'

Sequencing Primer
(F):5'- CACAAGTGATCACTACAAAGTAATGG -3'
(R):5'- CTGCCGCTTAGCATTCAGAAGAAAG -3'
Posted On2019-11-12