Mutagenetix > Incidental Mutation

Incidental Mutation 'R7687:Itga2'

593170

Institutional Source

Beutler Lab

Gene Symbol

Itga2

Ensembl Gene

ENSMUSG00000015533

Gene Name

integrin alpha 2

Synonyms

VLA-2 receptor, alpha 2 subunit, DX5, CD49B

Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114833081-114932100 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 114866260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 565 (G565C)

Ref Sequence

ENSEMBL: ENSMUSP00000053891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056117]

AlphaFold

Q62469

Predicted Effect

probably damaging
Transcript: ENSMUST00000056117
AA Change: G565C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: G565C

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Int_alpha	41	96	4.91e-4	SMART
VWA	169	359	2.42e-39	SMART
Blast:VWA	364	424	4e-26	BLAST
Int_alpha	430	481	2.59e-3	SMART
Int_alpha	484	541	3.5e-9	SMART
Int_alpha	547	602	3.11e-15	SMART
Int_alpha	611	669	2.52e-1	SMART
low complexity region	890	910	N/A	INTRINSIC
transmembrane domain	1129	1151	N/A	INTRINSIC
Pfam:Integrin_alpha	1152	1166	9e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,258,182	K2383R	probably benign	Het
Acly	C	T	11: 100,504,854		probably null	Het
Baiap3	T	A	17: 25,249,337	I276F	possibly damaging	Het
Cdc14b	A	T	13: 64,209,193	D419E	probably benign	Het
Celsr2	G	T	3: 108,397,769	P2165T	probably benign	Het
Clk4	A	G	11: 51,281,398	D476G	probably benign	Het
Dera	A	G	6: 137,836,880	T10A		Het
Dip2c	A	T	13: 9,604,581	T742S	probably benign	Het
Dohh	C	A	10: 81,387,806	A231E	probably benign	Het
Dot1l	T	G	10: 80,789,368	S1150A	possibly damaging	Het
Eea1	T	A	10: 96,026,598	I794N	probably benign	Het
En2	T	C	5: 28,170,289	S277P	probably damaging	Het
Erich1	A	G	8: 14,030,691	L276P	probably damaging	Het
Flnb	A	G	14: 7,924,224	N1779S	probably damaging	Het
Frzb	T	A	2: 80,424,635	T186S	probably benign	Het
Gdf7	T	A	12: 8,298,257	R347*	probably null	Het
Ighv9-4	T	C	12: 114,300,263	I17V	not run	Het
Ipo13	G	A	4: 117,911,891	P235S	probably benign	Het
Kcnc4	CCCGCCGCCGCCGCCGCCGCCGC	CCCGCCGCCGCCGCCGCCGCCGCCGC	3: 107,458,609		probably benign	Het
Kcnk10	A	G	12: 98,435,096	I440T	probably damaging	Het
Kdm3a	T	A	6: 71,599,492	K779N	possibly damaging	Het
Kmt2d	C	T	15: 98,862,120	D1086N	unknown	Het
Kntc1	A	G	5: 123,759,089	I172V	probably benign	Het
Maip1	A	G	1: 57,411,844	E215G	probably damaging	Het
Mms19	A	T	19: 41,955,168	M417K	possibly damaging	Het
Mslnl	T	C	17: 25,743,183	V185A	probably damaging	Het
Naa11	A	T	5: 97,391,789	V170E	probably benign	Het
Ncapg	C	T	5: 45,699,885	P980S	probably benign	Het
Olfr170	T	C	16: 19,605,735	N310S	probably benign	Het
Pbxip1	A	G	3: 89,448,199	D675G	probably damaging	Het
Pdlim5	A	G	3: 142,277,847	S382P	probably benign	Het
Pkd1l1	T	A	11: 8,854,390	I2184F		Het
Plau	A	G	14: 20,839,798	Y237C	probably damaging	Het
Ppl	T	C	16: 5,097,942	T586A	probably benign	Het
Rapgef6	T	G	11: 54,661,075	I923S	possibly damaging	Het
Rbfox2	C	T	15: 77,306,494	G17D	unknown	Het
Sema3b	T	C	9: 107,603,814	D108G	probably damaging	Het
Slc6a20a	A	G	9: 123,656,266	I297T	probably damaging	Het
Slit1	A	G	19: 41,650,689	F261L	probably benign	Het
Tcp10a	T	A	17: 7,345,108	V433D	probably damaging	Het
Tktl2	A	G	8: 66,513,101	E437G	probably damaging	Het
Tll1	G	T	8: 64,121,492	Y109*	probably null	Het
Tmem79	A	G	3: 88,332,581	V274A	probably damaging	Het
Tnfrsf23	G	A	7: 143,681,462	S55L	probably benign	Het
Ubd	T	C	17: 37,193,974		probably null	Het
Ubl3	C	A	5: 148,506,175	R105L	possibly damaging	Het
Ubl7	A	T	9: 57,914,584	D72V	probably damaging	Het
Wdr55	T	C	18: 36,762,023	S81P	probably damaging	Het
Wtip	T	C	7: 34,116,619	Y344C	probably damaging	Het
Zfp488	A	G	14: 33,970,400	S269P	possibly damaging	Het
Zkscan2	A	C	7: 123,499,862	S36A	probably benign	Het

Other mutations in Itga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Itga2	APN	13	114877625	missense	probably damaging	0.99
IGL01481:Itga2	APN	13	114859632	missense	possibly damaging	0.63
IGL01666:Itga2	APN	13	114837091	critical splice donor site	probably null
IGL01730:Itga2	APN	13	114854411	splice site	probably benign
IGL01965:Itga2	APN	13	114848064	splice site	probably benign
IGL01987:Itga2	APN	13	114847946	nonsense	probably null
IGL02334:Itga2	APN	13	114865309	critical splice donor site	probably null
IGL02381:Itga2	APN	13	114856722	missense	probably damaging	1.00
IGL02562:Itga2	APN	13	114836570	unclassified	probably benign
IGL03191:Itga2	APN	13	114836484	unclassified	probably benign
IGL03209:Itga2	APN	13	114880632	missense	probably damaging	1.00
P0007:Itga2	UTSW	13	114866199	missense	probably damaging	1.00
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0023:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0025:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0029:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	114870496	missense	possibly damaging	0.90
R0149:Itga2	UTSW	13	114836579	unclassified	probably benign
R0152:Itga2	UTSW	13	114866314	missense	probably benign	0.06
R0496:Itga2	UTSW	13	114853899	missense	probably benign	0.00
R0502:Itga2	UTSW	13	114845856	missense	probably benign	0.15
R0599:Itga2	UTSW	13	114856650	splice site	probably benign
R0688:Itga2	UTSW	13	114839554	missense	probably benign	0.00
R0704:Itga2	UTSW	13	114862375	missense	possibly damaging	0.91
R0760:Itga2	UTSW	13	114859632	missense	possibly damaging	0.63
R0811:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R0812:Itga2	UTSW	13	114870614	missense	possibly damaging	0.92
R0836:Itga2	UTSW	13	114856679	missense	probably damaging	0.99
R1196:Itga2	UTSW	13	114866155	critical splice donor site	probably null
R1546:Itga2	UTSW	13	114849420	missense	possibly damaging	0.63
R1639:Itga2	UTSW	13	114857296	missense	probably benign	0.00
R1834:Itga2	UTSW	13	114856726	missense	probably damaging	0.98
R1834:Itga2	UTSW	13	114856727	missense	probably damaging	1.00
R2180:Itga2	UTSW	13	114849381	missense	possibly damaging	0.67
R2190:Itga2	UTSW	13	114870605	missense	probably benign	0.05
R2518:Itga2	UTSW	13	114881042	missense	probably damaging	1.00
R3885:Itga2	UTSW	13	114869299	missense	probably benign	0.35
R3962:Itga2	UTSW	13	114839518	missense	probably damaging	0.99
R4094:Itga2	UTSW	13	114870625	missense	probably benign	0.01
R4193:Itga2	UTSW	13	114886649	nonsense	probably null
R4290:Itga2	UTSW	13	114866173	missense	probably damaging	0.98
R4459:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4460:Itga2	UTSW	13	114843483	missense	probably damaging	0.97
R4628:Itga2	UTSW	13	114877693	missense	probably benign	0.03
R4655:Itga2	UTSW	13	114873269	missense	probably benign	0.00
R4716:Itga2	UTSW	13	114857373	missense	probably damaging	0.98
R4896:Itga2	UTSW	13	114853766	nonsense	probably null
R5093:Itga2	UTSW	13	114856181	missense	probably benign	0.00
R5488:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5489:Itga2	UTSW	13	114843435	missense	probably damaging	1.00
R5743:Itga2	UTSW	13	114884506	missense	probably damaging	1.00
R5767:Itga2	UTSW	13	114839570	missense	possibly damaging	0.88
R5790:Itga2	UTSW	13	114868206	missense	probably benign	0.02
R5923:Itga2	UTSW	13	114884519	missense	probably benign	0.02
R6163:Itga2	UTSW	13	114866190	missense	probably damaging	1.00
R6227:Itga2	UTSW	13	114839561	missense	probably benign	0.30
R6278:Itga2	UTSW	13	114845888	missense	probably benign	0.05
R6283:Itga2	UTSW	13	114869250	missense	probably damaging	1.00
R6332:Itga2	UTSW	13	114843473	missense	probably benign
R6510:Itga2	UTSW	13	114873280	missense	probably damaging	1.00
R6742:Itga2	UTSW	13	114836525	missense	possibly damaging	0.93
R6869:Itga2	UTSW	13	114875537	splice site	probably null
R7073:Itga2	UTSW	13	114859613	missense	probably damaging	1.00
R7111:Itga2	UTSW	13	114900530	missense	unknown
R7236:Itga2	UTSW	13	114877691	missense	probably benign
R7269:Itga2	UTSW	13	114886689	nonsense	probably null
R7296:Itga2	UTSW	13	114857394	splice site	probably null
R7350:Itga2	UTSW	13	114837202	missense	probably damaging	0.98
R7375:Itga2	UTSW	13	114869217	missense	probably benign	0.06
R7501:Itga2	UTSW	13	114875559	missense	probably damaging	1.00
R7766:Itga2	UTSW	13	114853891	missense	probably benign
R7810:Itga2	UTSW	13	114866179	missense	probably benign	0.15
R8038:Itga2	UTSW	13	114853755	missense	probably damaging	1.00
R8948:Itga2	UTSW	13	114873330	missense	probably damaging	1.00
R9132:Itga2	UTSW	13	114877762	nonsense	probably null
R9153:Itga2	UTSW	13	114865405	missense	probably benign	0.00
R9159:Itga2	UTSW	13	114877762	nonsense	probably null
R9651:Itga2	UTSW	13	114884455	missense	probably benign	0.00
R9652:Itga2	UTSW	13	114884455	missense	probably benign	0.00
R9653:Itga2	UTSW	13	114884455	missense	probably benign	0.00
Z1088:Itga2	UTSW	13	114857332	missense	possibly damaging	0.46
Z1177:Itga2	UTSW	13	114853701	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGATGATGCGGTCTAGCTC -3'
(R):5'- ACTACACGTGGAGAATCATCAATAC -3'

Sequencing Primer
(F):5'- GCGGTCTAGCTCCAGCATTTATG -3'
(R):5'- GAAATCTTGTCTAGACATAGCTGC -3'

Posted On

2019-11-12