Incidental Mutation 'R7687:Ppl'
ID 593176
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Name periplakin
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 4904155-4950285 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4915806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 586 (T586A)
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035672
AA Change: T586A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: T586A

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 4,907,409 (GRCm39) missense probably benign 0.41
IGL00484:Ppl APN 16 4,905,816 (GRCm39) missense probably benign 0.13
IGL00654:Ppl APN 16 4,905,172 (GRCm39) missense possibly damaging 0.94
IGL00832:Ppl APN 16 4,906,839 (GRCm39) missense probably damaging 1.00
IGL01104:Ppl APN 16 4,912,355 (GRCm39) missense probably benign 0.01
IGL01327:Ppl APN 16 4,905,508 (GRCm39) missense probably benign 0.19
IGL01644:Ppl APN 16 4,909,719 (GRCm39) missense probably damaging 1.00
IGL01824:Ppl APN 16 4,905,753 (GRCm39) missense probably damaging 1.00
IGL02071:Ppl APN 16 4,930,936 (GRCm39) missense probably benign 0.04
IGL02085:Ppl APN 16 4,907,680 (GRCm39) missense probably benign 0.09
IGL02282:Ppl APN 16 4,919,322 (GRCm39) missense probably damaging 1.00
IGL02635:Ppl APN 16 4,907,631 (GRCm39) missense probably benign 0.01
IGL02649:Ppl APN 16 4,905,327 (GRCm39) missense probably damaging 1.00
IGL02888:Ppl APN 16 4,918,271 (GRCm39) missense possibly damaging 0.89
IGL03305:Ppl APN 16 4,911,097 (GRCm39) missense possibly damaging 0.62
G4846:Ppl UTSW 16 4,905,070 (GRCm39) missense probably damaging 1.00
IGL03097:Ppl UTSW 16 4,914,590 (GRCm39) missense probably damaging 0.98
R0759:Ppl UTSW 16 4,907,641 (GRCm39) missense probably benign 0.00
R0786:Ppl UTSW 16 4,906,918 (GRCm39) missense probably damaging 1.00
R1024:Ppl UTSW 16 4,917,864 (GRCm39) missense probably damaging 1.00
R1498:Ppl UTSW 16 4,922,629 (GRCm39) missense probably benign 0.05
R1544:Ppl UTSW 16 4,920,461 (GRCm39) nonsense probably null
R1597:Ppl UTSW 16 4,925,438 (GRCm39) missense probably benign 0.20
R1863:Ppl UTSW 16 4,905,844 (GRCm39) missense possibly damaging 0.69
R1921:Ppl UTSW 16 4,923,988 (GRCm39) missense possibly damaging 0.80
R2230:Ppl UTSW 16 4,906,845 (GRCm39) missense possibly damaging 0.51
R2275:Ppl UTSW 16 4,912,416 (GRCm39) missense probably benign 0.00
R2355:Ppl UTSW 16 4,912,361 (GRCm39) missense probably benign 0.00
R3410:Ppl UTSW 16 4,925,381 (GRCm39) missense possibly damaging 0.81
R3737:Ppl UTSW 16 4,924,721 (GRCm39) missense probably benign
R3797:Ppl UTSW 16 4,922,414 (GRCm39) splice site probably benign
R3968:Ppl UTSW 16 4,918,196 (GRCm39) splice site probably null
R3970:Ppl UTSW 16 4,918,196 (GRCm39) splice site probably null
R4034:Ppl UTSW 16 4,924,721 (GRCm39) missense probably benign
R4583:Ppl UTSW 16 4,922,400 (GRCm39) missense probably benign 0.02
R4639:Ppl UTSW 16 4,907,310 (GRCm39) missense probably damaging 1.00
R4762:Ppl UTSW 16 4,906,846 (GRCm39) missense probably benign 0.00
R4828:Ppl UTSW 16 4,922,790 (GRCm39) missense probably damaging 1.00
R4869:Ppl UTSW 16 4,922,753 (GRCm39) missense probably damaging 0.99
R4925:Ppl UTSW 16 4,922,846 (GRCm39) missense probably damaging 1.00
R4983:Ppl UTSW 16 4,906,582 (GRCm39) missense possibly damaging 0.75
R4984:Ppl UTSW 16 4,905,505 (GRCm39) missense probably benign
R4997:Ppl UTSW 16 4,907,235 (GRCm39) missense probably damaging 1.00
R5072:Ppl UTSW 16 4,906,742 (GRCm39) missense probably benign 0.01
R5073:Ppl UTSW 16 4,906,742 (GRCm39) missense probably benign 0.01
R5074:Ppl UTSW 16 4,906,742 (GRCm39) missense probably benign 0.01
R5286:Ppl UTSW 16 4,906,987 (GRCm39) nonsense probably null
R5398:Ppl UTSW 16 4,922,786 (GRCm39) missense probably benign 0.00
R5448:Ppl UTSW 16 4,925,430 (GRCm39) missense probably benign
R5664:Ppl UTSW 16 4,923,919 (GRCm39) missense probably benign 0.00
R5873:Ppl UTSW 16 4,923,913 (GRCm39) critical splice donor site probably null
R5918:Ppl UTSW 16 4,922,765 (GRCm39) missense probably benign 0.00
R5951:Ppl UTSW 16 4,906,492 (GRCm39) missense probably benign 0.25
R6038:Ppl UTSW 16 4,920,445 (GRCm39) missense possibly damaging 0.94
R6038:Ppl UTSW 16 4,920,445 (GRCm39) missense possibly damaging 0.94
R6088:Ppl UTSW 16 4,922,852 (GRCm39) missense possibly damaging 0.73
R6149:Ppl UTSW 16 4,925,460 (GRCm39) nonsense probably null
R6358:Ppl UTSW 16 4,905,793 (GRCm39) nonsense probably null
R6379:Ppl UTSW 16 4,915,555 (GRCm39) missense probably benign 0.02
R6468:Ppl UTSW 16 4,910,305 (GRCm39) missense probably damaging 1.00
R6514:Ppl UTSW 16 4,905,181 (GRCm39) missense probably damaging 1.00
R6528:Ppl UTSW 16 4,905,480 (GRCm39) missense probably benign 0.00
R6703:Ppl UTSW 16 4,907,328 (GRCm39) missense probably damaging 0.99
R6721:Ppl UTSW 16 4,925,333 (GRCm39) missense probably damaging 0.97
R6811:Ppl UTSW 16 4,907,008 (GRCm39) missense probably damaging 0.99
R6934:Ppl UTSW 16 4,912,373 (GRCm39) missense probably benign 0.00
R7034:Ppl UTSW 16 4,905,366 (GRCm39) missense probably benign 0.29
R7076:Ppl UTSW 16 4,917,983 (GRCm39) missense probably damaging 1.00
R7300:Ppl UTSW 16 4,920,235 (GRCm39) missense possibly damaging 0.87
R7349:Ppl UTSW 16 4,922,593 (GRCm39) missense probably damaging 0.99
R7359:Ppl UTSW 16 4,907,205 (GRCm39) missense possibly damaging 0.78
R7378:Ppl UTSW 16 4,930,860 (GRCm39) missense possibly damaging 0.91
R7383:Ppl UTSW 16 4,915,835 (GRCm39) missense probably damaging 1.00
R7389:Ppl UTSW 16 4,924,577 (GRCm39) splice site probably null
R7445:Ppl UTSW 16 4,906,932 (GRCm39) missense probably damaging 1.00
R7752:Ppl UTSW 16 4,920,166 (GRCm39) missense probably benign 0.09
R7827:Ppl UTSW 16 4,905,828 (GRCm39) missense probably damaging 1.00
R7836:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7842:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7896:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7898:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R7943:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R8122:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R8126:Ppl UTSW 16 4,906,725 (GRCm39) missense probably damaging 1.00
R8284:Ppl UTSW 16 4,950,201 (GRCm39) missense probably damaging 1.00
R8680:Ppl UTSW 16 4,905,300 (GRCm39) missense probably benign 0.01
R8781:Ppl UTSW 16 4,915,800 (GRCm39) missense possibly damaging 0.68
R8835:Ppl UTSW 16 4,906,854 (GRCm39) missense probably damaging 0.99
R8836:Ppl UTSW 16 4,906,854 (GRCm39) missense probably damaging 0.99
R8837:Ppl UTSW 16 4,906,854 (GRCm39) missense probably damaging 0.99
R8866:Ppl UTSW 16 4,920,211 (GRCm39) missense probably benign 0.12
R8894:Ppl UTSW 16 4,925,206 (GRCm39) intron probably benign
R8922:Ppl UTSW 16 4,923,815 (GRCm39) missense probably benign
R8927:Ppl UTSW 16 4,905,474 (GRCm39) missense probably benign 0.19
R8928:Ppl UTSW 16 4,905,474 (GRCm39) missense probably benign 0.19
R9070:Ppl UTSW 16 4,907,208 (GRCm39) missense probably benign 0.00
R9314:Ppl UTSW 16 4,922,367 (GRCm39) missense possibly damaging 0.79
R9642:Ppl UTSW 16 4,915,602 (GRCm39) missense probably benign 0.01
RF009:Ppl UTSW 16 4,915,795 (GRCm39) missense probably benign 0.00
X0054:Ppl UTSW 16 4,922,766 (GRCm39) missense probably benign 0.00
Z1088:Ppl UTSW 16 4,907,371 (GRCm39) missense probably damaging 0.97
Z1176:Ppl UTSW 16 4,924,642 (GRCm39) missense probably damaging 0.99
Z1177:Ppl UTSW 16 4,915,821 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCTGTTCTCGTATGAGG -3'
(R):5'- TCCTTGACGGAAGAGAGCTGTAG -3'

Sequencing Primer
(F):5'- TTCTCGTATGAGGCCAGCAG -3'
(R):5'- AGGGCTGTGGTTGACCC -3'
Posted On 2019-11-12