Incidental Mutation 'R7687:Olfr170'
ID593177
Institutional Source Beutler Lab
Gene Symbol Olfr170
Ensembl Gene ENSMUSG00000062245
Gene Nameolfactory receptor 170
SynonymsGA_x54KRFPKG5P-16052703-16051765, MOR273-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location19605696-19611882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19605735 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 310 (N310S)
Ref Sequence ENSEMBL: ENSMUSP00000145775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]
Predicted Effect probably benign
Transcript: ENSMUST00000078603
AA Change: N310S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: N310S

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.5e-43 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206562
AA Change: N310S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218837
AA Change: N311S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Olfr170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Olfr170 APN 16 19605921 missense probably benign 0.00
IGL02002:Olfr170 APN 16 19606550 missense possibly damaging 0.91
IGL02537:Olfr170 APN 16 19605799 missense probably damaging 1.00
IGL02881:Olfr170 APN 16 19606300 missense probably damaging 1.00
IGL03189:Olfr170 APN 16 19606591 missense probably benign
R0012:Olfr170 UTSW 16 19606440 missense probably benign 0.30
R0619:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R0764:Olfr170 UTSW 16 19606432 missense probably damaging 1.00
R1387:Olfr170 UTSW 16 19606027 missense probably damaging 1.00
R1430:Olfr170 UTSW 16 19606002 missense probably damaging 1.00
R1503:Olfr170 UTSW 16 19606312 missense probably benign 0.19
R1878:Olfr170 UTSW 16 19605751 missense probably benign
R1989:Olfr170 UTSW 16 19606657 missense probably benign 0.00
R2012:Olfr170 UTSW 16 19606131 missense probably benign 0.22
R3890:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R3891:Olfr170 UTSW 16 19606455 missense probably damaging 1.00
R5591:Olfr170 UTSW 16 19605858 missense probably damaging 1.00
R6158:Olfr170 UTSW 16 19605925 missense probably damaging 1.00
R6297:Olfr170 UTSW 16 19605930 missense possibly damaging 0.81
R6512:Olfr170 UTSW 16 19606359 missense probably damaging 1.00
R6962:Olfr170 UTSW 16 19605922 missense probably benign 0.00
R7252:Olfr170 UTSW 16 19606499 missense probably damaging 0.99
R7605:Olfr170 UTSW 16 19606272 missense probably damaging 1.00
R8302:Olfr170 UTSW 16 19606366 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGACATCCCTGCTGTTCCTG -3'
(R):5'- GGCCAGTCATTTTCACATATATGAGAC -3'

Sequencing Primer
(F):5'- TGCTGTTCCTGCTACAGATATG -3'
(R):5'- CATTTTCACATATATGAGACCTCGC -3'
Posted On2019-11-12