Mutagenetix > Incidental Mutation

Incidental Mutation 'R7687:Baiap3'

593179

Institutional Source

Beutler Lab

Gene Symbol

Baiap3

Ensembl Gene

ENSMUSG00000047507

Gene Name

BAI1-associated protein 3

Synonyms

LOC381076

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25242659-25256364 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25249337 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 276 (I276F)

Ref Sequence

ENSEMBL: ENSMUSP00000138188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169109] [ENSMUST00000182056] [ENSMUST00000182435] [ENSMUST00000182825]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000129854
Gene: ENSMUSG00000047507
AA Change: I253F

Domain	Start	End	E-Value	Type
C2	159	328	4.73e-17	SMART
low complexity region	361	379	N/A	INTRINSIC
low complexity region	434	445	N/A	INTRINSIC
low complexity region	497	509	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	857	868	N/A	INTRINSIC
Pfam:Membr_traf_MHD	896	958	8e-10	PFAM
C2	989	1097	7.06e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182056
AA Change: I276F

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138188
Gene: ENSMUSG00000047507
AA Change: I276F

Domain	Start	End	E-Value	Type
C2	159	328	4.73e-17	SMART
low complexity region	361	379	N/A	INTRINSIC
low complexity region	434	445	N/A	INTRINSIC
low complexity region	497	509	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
Pfam:Membr_traf_MHD	851	959	3.3e-30	PFAM
C2	989	1097	7.06e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182435
AA Change: I248F

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138796
Gene: ENSMUSG00000047507
AA Change: I248F

Domain	Start	End	E-Value	Type
C2	131	300	4.73e-17	SMART
low complexity region	333	351	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	664	676	N/A	INTRINSIC
Pfam:Membr_traf_MHD	823	931	3.2e-30	PFAM
C2	961	1069	7.06e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182825
AA Change: I276F

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000138254
Gene: ENSMUSG00000047507
AA Change: I276F

Domain	Start	End	E-Value	Type
C2	159	284	4.05e-16	SMART
low complexity region	325	343	N/A	INTRINSIC
low complexity region	398	409	N/A	INTRINSIC
low complexity region	461	473	N/A	INTRINSIC
low complexity region	656	668	N/A	INTRINSIC
Pfam:Membr_traf_MHD	815	923	3.2e-30	PFAM
C2	953	1061	7.06e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile but exhibit increased PTZ-induced seizure propensity, as well as increased novelty-induced anxiety in both genders, with a more pronounced effect in females, and a faster developmentof tolerance to benzodiazepines in male mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,258,182	K2383R	probably benign	Het
Acly	C	T	11: 100,504,854		probably null	Het
Cdc14b	A	T	13: 64,209,193	D419E	probably benign	Het
Celsr2	G	T	3: 108,397,769	P2165T	probably benign	Het
Clk4	A	G	11: 51,281,398	D476G	probably benign	Het
Dera	A	G	6: 137,836,880	T10A		Het
Dip2c	A	T	13: 9,604,581	T742S	probably benign	Het
Dohh	C	A	10: 81,387,806	A231E	probably benign	Het
Dot1l	T	G	10: 80,789,368	S1150A	possibly damaging	Het
Eea1	T	A	10: 96,026,598	I794N	probably benign	Het
En2	T	C	5: 28,170,289	S277P	probably damaging	Het
Erich1	A	G	8: 14,030,691	L276P	probably damaging	Het
Flnb	A	G	14: 7,924,224	N1779S	probably damaging	Het
Frzb	T	A	2: 80,424,635	T186S	probably benign	Het
Gdf7	T	A	12: 8,298,257	R347*	probably null	Het
Ighv9-4	T	C	12: 114,300,263	I17V	not run	Het
Ipo13	G	A	4: 117,911,891	P235S	probably benign	Het
Itga2	C	A	13: 114,866,260	G565C	probably damaging	Het
Kcnc4	CCCGCCGCCGCCGCCGCCGCCGC	CCCGCCGCCGCCGCCGCCGCCGCCGC	3: 107,458,609		probably benign	Het
Kcnk10	A	G	12: 98,435,096	I440T	probably damaging	Het
Kdm3a	T	A	6: 71,599,492	K779N	possibly damaging	Het
Kmt2d	C	T	15: 98,862,120	D1086N	unknown	Het
Kntc1	A	G	5: 123,759,089	I172V	probably benign	Het
Maip1	A	G	1: 57,411,844	E215G	probably damaging	Het
Mms19	A	T	19: 41,955,168	M417K	possibly damaging	Het
Mslnl	T	C	17: 25,743,183	V185A	probably damaging	Het
Naa11	A	T	5: 97,391,789	V170E	probably benign	Het
Ncapg	C	T	5: 45,699,885	P980S	probably benign	Het
Olfr170	T	C	16: 19,605,735	N310S	probably benign	Het
Pbxip1	A	G	3: 89,448,199	D675G	probably damaging	Het
Pdlim5	A	G	3: 142,277,847	S382P	probably benign	Het
Pkd1l1	T	A	11: 8,854,390	I2184F		Het
Plau	A	G	14: 20,839,798	Y237C	probably damaging	Het
Ppl	T	C	16: 5,097,942	T586A	probably benign	Het
Rapgef6	T	G	11: 54,661,075	I923S	possibly damaging	Het
Rbfox2	C	T	15: 77,306,494	G17D	unknown	Het
Sema3b	T	C	9: 107,603,814	D108G	probably damaging	Het
Slc6a20a	A	G	9: 123,656,266	I297T	probably damaging	Het
Slit1	A	G	19: 41,650,689	F261L	probably benign	Het
Tcp10a	T	A	17: 7,345,108	V433D	probably damaging	Het
Tktl2	A	G	8: 66,513,101	E437G	probably damaging	Het
Tll1	G	T	8: 64,121,492	Y109*	probably null	Het
Tmem79	A	G	3: 88,332,581	V274A	probably damaging	Het
Tnfrsf23	G	A	7: 143,681,462	S55L	probably benign	Het
Ubd	T	C	17: 37,193,974		probably null	Het
Ubl3	C	A	5: 148,506,175	R105L	possibly damaging	Het
Ubl7	A	T	9: 57,914,584	D72V	probably damaging	Het
Wdr55	T	C	18: 36,762,023	S81P	probably damaging	Het
Wtip	T	C	7: 34,116,619	Y344C	probably damaging	Het
Zfp488	A	G	14: 33,970,400	S269P	possibly damaging	Het
Zkscan2	A	C	7: 123,499,862	S36A	probably benign	Het

Other mutations in Baiap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Baiap3	APN	17	25244328	missense	probably damaging	1.00
IGL00486:Baiap3	APN	17	25248377	splice site	probably benign
IGL00820:Baiap3	APN	17	25248690	missense	probably benign	0.20
IGL01443:Baiap3	APN	17	25245147	missense	possibly damaging	0.92
IGL02282:Baiap3	APN	17	25249377	missense	probably benign	0.11
IGL02341:Baiap3	APN	17	25248316	missense	possibly damaging	0.52
IGL02669:Baiap3	APN	17	25244348	missense	probably damaging	1.00
IGL02863:Baiap3	APN	17	25244502	splice site	probably benign
IGL02993:Baiap3	APN	17	25250082	critical splice donor site	probably null
R0021:Baiap3	UTSW	17	25243669	missense	probably damaging	1.00
R0090:Baiap3	UTSW	17	25250070	splice site	probably benign
R0276:Baiap3	UTSW	17	25243687	missense	probably damaging	1.00
R0488:Baiap3	UTSW	17	25248470	critical splice donor site	probably null
R0826:Baiap3	UTSW	17	25245229	missense	possibly damaging	0.89
R0883:Baiap3	UTSW	17	25249101	missense	probably damaging	1.00
R1700:Baiap3	UTSW	17	25249328	missense	probably damaging	1.00
R1702:Baiap3	UTSW	17	25244805	missense	probably damaging	1.00
R2336:Baiap3	UTSW	17	25250404	missense	probably damaging	1.00
R2762:Baiap3	UTSW	17	25244575	missense	probably damaging	1.00
R4454:Baiap3	UTSW	17	25249536	missense	probably damaging	1.00
R4540:Baiap3	UTSW	17	25246670	missense	probably damaging	1.00
R4609:Baiap3	UTSW	17	25250261	missense	probably damaging	1.00
R4816:Baiap3	UTSW	17	25247295	splice site	probably benign
R4979:Baiap3	UTSW	17	25246362	missense	possibly damaging	0.57
R5069:Baiap3	UTSW	17	25249108	missense	probably damaging	0.99
R5070:Baiap3	UTSW	17	25249108	missense	probably damaging	0.99
R5093:Baiap3	UTSW	17	25250269	missense	probably damaging	1.00
R5130:Baiap3	UTSW	17	25245342	missense	probably benign	0.01
R5566:Baiap3	UTSW	17	25251733	missense	probably damaging	1.00
R5572:Baiap3	UTSW	17	25251475	missense	possibly damaging	0.86
R5681:Baiap3	UTSW	17	25249373	missense	probably damaging	1.00
R5730:Baiap3	UTSW	17	25247524	missense	probably benign	0.01
R5743:Baiap3	UTSW	17	25244785	missense	probably benign	0.02
R5805:Baiap3	UTSW	17	25247515	missense	probably benign	0.12
R6038:Baiap3	UTSW	17	25246334	missense	probably damaging	1.00
R6038:Baiap3	UTSW	17	25246334	missense	probably damaging	1.00
R6052:Baiap3	UTSW	17	25248470	critical splice donor site	probably benign
R6238:Baiap3	UTSW	17	25245758	missense	probably benign	0.00
R6700:Baiap3	UTSW	17	25244026	missense	probably damaging	1.00
R7037:Baiap3	UTSW	17	25243840	missense	probably benign
R7038:Baiap3	UTSW	17	25243840	missense	probably benign
R7039:Baiap3	UTSW	17	25243840	missense	probably benign
R7126:Baiap3	UTSW	17	25245145	missense	possibly damaging	0.64
R7198:Baiap3	UTSW	17	25243840	missense	probably benign
R7223:Baiap3	UTSW	17	25243840	missense	probably benign
R7291:Baiap3	UTSW	17	25244317	missense	probably damaging	1.00
R7438:Baiap3	UTSW	17	25249108	missense	possibly damaging	0.91
R7877:Baiap3	UTSW	17	25251138	missense	probably damaging	0.99
R8172:Baiap3	UTSW	17	25244122	missense	probably damaging	1.00
R8184:Baiap3	UTSW	17	25248525	missense	probably benign	0.00
R8230:Baiap3	UTSW	17	25246853	missense	probably benign	0.00
R8240:Baiap3	UTSW	17	25245314	critical splice donor site	probably null
R8394:Baiap3	UTSW	17	25250122	missense	probably benign
R8972:Baiap3	UTSW	17	25247036	missense	probably benign	0.04
R9274:Baiap3	UTSW	17	25244380	missense	probably damaging	0.96
R9333:Baiap3	UTSW	17	25248702	missense	possibly damaging	0.54
R9388:Baiap3	UTSW	17	25247135	critical splice donor site	probably null
X0017:Baiap3	UTSW	17	25248350	missense	possibly damaging	0.92
Z1176:Baiap3	UTSW	17	25244768	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- CATCAGTGTGGTCCTCAGTG -3'
(R):5'- CACCTGGACATATGGTAGAGGAC -3'

Sequencing Primer
(F):5'- ATTTGCACGGGCCGACTTG -3'
(R):5'- TAGAGGACCCCAAGCTCTG -3'

Posted On

2019-11-12