Incidental Mutation 'R7687:Slit1'
ID 593183
Institutional Source Beutler Lab
Gene Symbol Slit1
Ensembl Gene ENSMUSG00000025020
Gene Name slit guidance ligand 1
Synonyms Slil1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 41588696-41732104 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41639128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 261 (F261L)
Ref Sequence ENSEMBL: ENSMUSP00000025993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025993] [ENSMUST00000166496] [ENSMUST00000169141] [ENSMUST00000171586]
AlphaFold Q80TR4
Predicted Effect probably benign
Transcript: ENSMUST00000025993
AA Change: F261L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025993
Gene: ENSMUSG00000025020
AA Change: F261L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
CT 1462 1531 3.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166496
AA Change: F261L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128381
Gene: ENSMUSG00000025020
AA Change: F261L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
low complexity region 1437 1458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169141
AA Change: F261L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129034
Gene: ENSMUSG00000025020
AA Change: F261L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171586
AA Change: F237L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126139
Gene: ENSMUSG00000025020
AA Change: F237L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 2.24e-3 SMART
LRR 133 155 3.98e1 SMART
LRR_TYP 156 179 3.44e-4 SMART
LRRCT 191 240 3.51e-6 SMART
LRRNT 257 289 3e-8 SMART
LRR 283 307 6.41e1 SMART
LRR_TYP 308 331 8.22e-2 SMART
LRR_TYP 332 355 9.08e-4 SMART
LRR 356 379 2.82e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal interneuron numbers and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mms19 A T 19: 41,943,607 (GRCm39) M417K possibly damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Slit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Slit1 APN 19 41,639,274 (GRCm39) missense probably damaging 1.00
IGL00515:Slit1 APN 19 41,612,940 (GRCm39) missense probably damaging 0.97
IGL00909:Slit1 APN 19 41,590,694 (GRCm39) missense possibly damaging 0.89
IGL00953:Slit1 APN 19 41,590,739 (GRCm39) missense probably damaging 1.00
IGL01116:Slit1 APN 19 41,594,824 (GRCm39) missense possibly damaging 0.93
IGL01457:Slit1 APN 19 41,599,483 (GRCm39) missense probably damaging 1.00
IGL01688:Slit1 APN 19 41,717,545 (GRCm39) missense probably damaging 1.00
IGL01720:Slit1 APN 19 41,622,653 (GRCm39) missense probably benign 0.01
IGL01925:Slit1 APN 19 41,596,817 (GRCm39) missense probably damaging 0.98
IGL02008:Slit1 APN 19 41,634,579 (GRCm39) missense probably damaging 0.99
IGL02312:Slit1 APN 19 41,590,119 (GRCm39) missense possibly damaging 0.66
IGL02398:Slit1 APN 19 41,590,676 (GRCm39) missense probably damaging 1.00
IGL02542:Slit1 APN 19 41,615,687 (GRCm39) missense probably damaging 1.00
IGL02559:Slit1 APN 19 41,709,524 (GRCm39) missense probably benign 0.01
IGL02609:Slit1 APN 19 41,590,743 (GRCm39) missense probably damaging 0.99
IGL02623:Slit1 APN 19 41,640,122 (GRCm39) missense probably damaging 0.98
IGL02729:Slit1 APN 19 41,591,773 (GRCm39) missense probably damaging 1.00
IGL03230:Slit1 APN 19 41,717,524 (GRCm39) missense probably damaging 1.00
IGL03387:Slit1 APN 19 41,591,881 (GRCm39) missense possibly damaging 0.57
PIT4576001:Slit1 UTSW 19 41,612,988 (GRCm39) missense possibly damaging 0.52
R0366:Slit1 UTSW 19 41,599,470 (GRCm39) missense probably damaging 1.00
R0432:Slit1 UTSW 19 41,731,732 (GRCm39) missense probably damaging 0.98
R0496:Slit1 UTSW 19 41,596,750 (GRCm39) splice site probably benign
R0722:Slit1 UTSW 19 41,596,874 (GRCm39) missense probably damaging 1.00
R1468:Slit1 UTSW 19 41,596,823 (GRCm39) missense probably damaging 1.00
R1468:Slit1 UTSW 19 41,596,823 (GRCm39) missense probably damaging 1.00
R1488:Slit1 UTSW 19 41,596,824 (GRCm39) missense probably damaging 1.00
R1615:Slit1 UTSW 19 41,639,110 (GRCm39) splice site probably benign
R1694:Slit1 UTSW 19 41,626,031 (GRCm39) missense possibly damaging 0.69
R1762:Slit1 UTSW 19 41,591,774 (GRCm39) missense probably damaging 1.00
R1842:Slit1 UTSW 19 41,709,477 (GRCm39) critical splice donor site probably null
R1844:Slit1 UTSW 19 41,614,012 (GRCm39) missense probably damaging 1.00
R1940:Slit1 UTSW 19 41,619,215 (GRCm39) missense probably damaging 1.00
R2087:Slit1 UTSW 19 41,625,922 (GRCm39) missense probably benign 0.00
R2094:Slit1 UTSW 19 41,594,819 (GRCm39) missense probably damaging 0.99
R2095:Slit1 UTSW 19 41,594,819 (GRCm39) missense probably damaging 0.99
R2104:Slit1 UTSW 19 41,590,686 (GRCm39) missense possibly damaging 0.69
R2305:Slit1 UTSW 19 41,599,455 (GRCm39) missense probably benign 0.03
R2972:Slit1 UTSW 19 41,599,455 (GRCm39) missense probably benign 0.03
R2973:Slit1 UTSW 19 41,599,455 (GRCm39) missense probably benign 0.03
R2974:Slit1 UTSW 19 41,599,455 (GRCm39) missense probably benign 0.03
R3159:Slit1 UTSW 19 41,592,812 (GRCm39) missense probably benign
R3752:Slit1 UTSW 19 41,635,406 (GRCm39) critical splice donor site probably null
R4095:Slit1 UTSW 19 41,596,925 (GRCm39) intron probably benign
R4282:Slit1 UTSW 19 41,602,856 (GRCm39) missense probably benign
R4417:Slit1 UTSW 19 41,602,908 (GRCm39) missense probably damaging 1.00
R4607:Slit1 UTSW 19 41,605,232 (GRCm39) missense probably benign 0.10
R4729:Slit1 UTSW 19 41,635,459 (GRCm39) missense probably damaging 1.00
R4756:Slit1 UTSW 19 41,637,452 (GRCm39) missense probably damaging 1.00
R4764:Slit1 UTSW 19 41,709,483 (GRCm39) nonsense probably null
R4849:Slit1 UTSW 19 41,637,983 (GRCm39) missense probably benign 0.17
R4874:Slit1 UTSW 19 41,717,493 (GRCm39) critical splice donor site probably null
R5581:Slit1 UTSW 19 41,605,102 (GRCm39) critical splice donor site probably null
R5699:Slit1 UTSW 19 41,613,959 (GRCm39) critical splice donor site probably null
R5888:Slit1 UTSW 19 41,731,735 (GRCm39) missense probably damaging 1.00
R5906:Slit1 UTSW 19 41,594,813 (GRCm39) missense probably damaging 1.00
R6176:Slit1 UTSW 19 41,626,034 (GRCm39) missense probably damaging 1.00
R6277:Slit1 UTSW 19 41,588,948 (GRCm39) missense possibly damaging 0.81
R6702:Slit1 UTSW 19 41,603,309 (GRCm39) missense possibly damaging 0.95
R6860:Slit1 UTSW 19 41,605,154 (GRCm39) missense probably benign 0.10
R7015:Slit1 UTSW 19 41,618,325 (GRCm39) nonsense probably null
R7172:Slit1 UTSW 19 41,623,105 (GRCm39) missense probably damaging 1.00
R7512:Slit1 UTSW 19 41,589,074 (GRCm39) missense probably damaging 1.00
R7568:Slit1 UTSW 19 41,590,074 (GRCm39) missense probably damaging 1.00
R7614:Slit1 UTSW 19 41,622,639 (GRCm39) missense probably damaging 1.00
R7650:Slit1 UTSW 19 41,618,363 (GRCm39) missense probably damaging 1.00
R7732:Slit1 UTSW 19 41,592,847 (GRCm39) missense probably benign 0.01
R7947:Slit1 UTSW 19 41,599,248 (GRCm39) missense probably benign
R7947:Slit1 UTSW 19 41,599,247 (GRCm39) missense probably damaging 1.00
R8171:Slit1 UTSW 19 41,715,512 (GRCm39) missense probably damaging 0.97
R8217:Slit1 UTSW 19 41,612,959 (GRCm39) missense possibly damaging 0.60
R8355:Slit1 UTSW 19 41,634,473 (GRCm39) missense probably damaging 1.00
R9025:Slit1 UTSW 19 41,612,968 (GRCm39) missense probably benign 0.01
R9124:Slit1 UTSW 19 41,594,951 (GRCm39) missense probably benign 0.02
R9288:Slit1 UTSW 19 41,613,144 (GRCm39) intron probably benign
R9343:Slit1 UTSW 19 41,615,737 (GRCm39) missense probably damaging 1.00
R9435:Slit1 UTSW 19 41,591,764 (GRCm39) critical splice donor site probably null
R9563:Slit1 UTSW 19 41,596,874 (GRCm39) missense probably damaging 1.00
R9564:Slit1 UTSW 19 41,591,861 (GRCm39) missense probably benign 0.16
R9595:Slit1 UTSW 19 41,637,851 (GRCm39) missense probably damaging 1.00
R9667:Slit1 UTSW 19 41,731,832 (GRCm39) nonsense probably null
X0023:Slit1 UTSW 19 41,590,079 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTAACACAGCTGTGGTGAAGC -3'
(R):5'- GAGCTGCTGTTCTCCTGTAG -3'

Sequencing Primer
(F):5'- AGTGACTGGTGTATGGAGCAG -3'
(R):5'- GTTCTCCTGTAGCCGGCTG -3'
Posted On 2019-11-12