Incidental Mutation 'R7687:Mms19'
ID 593184
Institutional Source Beutler Lab
Gene Symbol Mms19
Ensembl Gene ENSMUSG00000025159
Gene Name MMS19 cytosolic iron-sulfur assembly component
Synonyms 2610042O15Rik, Mms19l, C86341, Mms19
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R7687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 41932146-41969603 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41943607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 417 (M417K)
Ref Sequence ENSEMBL: ENSMUSP00000130900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026168] [ENSMUST00000163287] [ENSMUST00000163398] [ENSMUST00000164776] [ENSMUST00000167820] [ENSMUST00000167927] [ENSMUST00000168484] [ENSMUST00000169775] [ENSMUST00000171561]
AlphaFold Q9D071
Predicted Effect possibly damaging
Transcript: ENSMUST00000026168
AA Change: M374K

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026168
Gene: ENSMUSG00000025159
AA Change: M374K

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.4e-29 PFAM
Pfam:MMS19_N 163 270 2.4e-44 PFAM
low complexity region 329 343 N/A INTRINSIC
Pfam:MMS19_C 484 921 4.3e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163287
AA Change: M271K

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128653
Gene: ENSMUSG00000025159
AA Change: M271K

DomainStartEndE-ValueType
Pfam:MMS19_N 3 265 9.8e-97 PFAM
Pfam:MMS19_C 381 818 1e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163398
Predicted Effect probably benign
Transcript: ENSMUST00000164776
Predicted Effect probably benign
Transcript: ENSMUST00000166090
SMART Domains Protein: ENSMUSP00000131219
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 102 494 2.2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167820
SMART Domains Protein: ENSMUSP00000130399
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 63 286 7.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168484
SMART Domains Protein: ENSMUSP00000126881
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169775
SMART Domains Protein: ENSMUSP00000128234
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.5e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171561
AA Change: M417K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159
AA Change: M417K

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,297,341 (GRCm39) K2383R probably benign Het
Acly C T 11: 100,395,680 (GRCm39) probably null Het
Baiap3 T A 17: 25,468,311 (GRCm39) I276F possibly damaging Het
Cdc14b A T 13: 64,357,007 (GRCm39) D419E probably benign Het
Celsr2 G T 3: 108,305,085 (GRCm39) P2165T probably benign Het
Clk4 A G 11: 51,172,225 (GRCm39) D476G probably benign Het
Dera A G 6: 137,813,878 (GRCm39) T10A Het
Dip2c A T 13: 9,654,617 (GRCm39) T742S probably benign Het
Dohh C A 10: 81,223,640 (GRCm39) A231E probably benign Het
Dot1l T G 10: 80,625,202 (GRCm39) S1150A possibly damaging Het
Eea1 T A 10: 95,862,460 (GRCm39) I794N probably benign Het
En2 T C 5: 28,375,287 (GRCm39) S277P probably damaging Het
Erich1 A G 8: 14,080,691 (GRCm39) L276P probably damaging Het
Flnb A G 14: 7,924,224 (GRCm38) N1779S probably damaging Het
Frzb T A 2: 80,254,979 (GRCm39) T186S probably benign Het
Gdf7 T A 12: 8,348,257 (GRCm39) R347* probably null Het
Ighv9-4 T C 12: 114,263,883 (GRCm39) I17V not run Het
Ipo13 G A 4: 117,769,088 (GRCm39) P235S probably benign Het
Itga2 C A 13: 115,002,796 (GRCm39) G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,365,925 (GRCm39) probably benign Het
Kcnk10 A G 12: 98,401,355 (GRCm39) I440T probably damaging Het
Kdm3a T A 6: 71,576,476 (GRCm39) K779N possibly damaging Het
Kmt2d C T 15: 98,760,001 (GRCm39) D1086N unknown Het
Kntc1 A G 5: 123,897,152 (GRCm39) I172V probably benign Het
Maip1 A G 1: 57,451,003 (GRCm39) E215G probably damaging Het
Mslnl T C 17: 25,962,157 (GRCm39) V185A probably damaging Het
Naa11 A T 5: 97,539,648 (GRCm39) V170E probably benign Het
Ncapg C T 5: 45,857,227 (GRCm39) P980S probably benign Het
Or2aj5 T C 16: 19,424,485 (GRCm39) N310S probably benign Het
Pbxip1 A G 3: 89,355,506 (GRCm39) D675G probably damaging Het
Pdlim5 A G 3: 141,983,608 (GRCm39) S382P probably benign Het
Pkd1l1 T A 11: 8,804,390 (GRCm39) I2184F Het
Plau A G 14: 20,889,866 (GRCm39) Y237C probably damaging Het
Ppl T C 16: 4,915,806 (GRCm39) T586A probably benign Het
Rapgef6 T G 11: 54,551,901 (GRCm39) I923S possibly damaging Het
Rbfox2 C T 15: 77,190,694 (GRCm39) G17D unknown Het
Sema3b T C 9: 107,481,013 (GRCm39) D108G probably damaging Het
Slc6a20a A G 9: 123,485,331 (GRCm39) I297T probably damaging Het
Slit1 A G 19: 41,639,128 (GRCm39) F261L probably benign Het
Tcp10a T A 17: 7,612,507 (GRCm39) V433D probably damaging Het
Tktl2 A G 8: 66,965,753 (GRCm39) E437G probably damaging Het
Tll1 G T 8: 64,574,526 (GRCm39) Y109* probably null Het
Tmem79 A G 3: 88,239,888 (GRCm39) V274A probably damaging Het
Tnfrsf23 G A 7: 143,235,199 (GRCm39) S55L probably benign Het
Ubd T C 17: 37,504,865 (GRCm39) probably null Het
Ubl3 C A 5: 148,442,985 (GRCm39) R105L possibly damaging Het
Ubl7 A T 9: 57,821,867 (GRCm39) D72V probably damaging Het
Wdr55 T C 18: 36,895,076 (GRCm39) S81P probably damaging Het
Wtip T C 7: 33,816,044 (GRCm39) Y344C probably damaging Het
Zfp488 A G 14: 33,692,357 (GRCm39) S269P possibly damaging Het
Zkscan2 A C 7: 123,099,085 (GRCm39) S36A probably benign Het
Other mutations in Mms19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Mms19 APN 19 41,936,672 (GRCm39) missense probably benign 0.12
IGL00157:Mms19 APN 19 41,933,896 (GRCm39) critical splice donor site probably null
IGL01997:Mms19 APN 19 41,944,970 (GRCm39) missense probably damaging 1.00
IGL02081:Mms19 APN 19 41,938,418 (GRCm39) critical splice donor site probably null
IGL02171:Mms19 APN 19 41,945,578 (GRCm39) critical splice donor site probably null
IGL02306:Mms19 APN 19 41,954,703 (GRCm39) missense probably damaging 1.00
IGL02678:Mms19 APN 19 41,942,915 (GRCm39) missense possibly damaging 0.84
IGL02795:Mms19 APN 19 41,940,845 (GRCm39) critical splice donor site probably null
IGL03233:Mms19 APN 19 41,935,352 (GRCm39) splice site probably null
IGL03250:Mms19 APN 19 41,942,903 (GRCm39) critical splice donor site probably null
R0049:Mms19 UTSW 19 41,943,607 (GRCm39) missense probably damaging 0.99
R0049:Mms19 UTSW 19 41,943,607 (GRCm39) missense probably damaging 0.99
R0480:Mms19 UTSW 19 41,943,285 (GRCm39) missense probably damaging 0.98
R0498:Mms19 UTSW 19 41,938,212 (GRCm39) missense possibly damaging 0.82
R0505:Mms19 UTSW 19 41,942,173 (GRCm39) missense probably damaging 1.00
R0547:Mms19 UTSW 19 41,951,857 (GRCm39) missense probably damaging 0.99
R1102:Mms19 UTSW 19 41,939,284 (GRCm39) missense possibly damaging 0.77
R1183:Mms19 UTSW 19 41,943,270 (GRCm39) missense possibly damaging 0.83
R1544:Mms19 UTSW 19 41,944,260 (GRCm39) critical splice donor site probably null
R1666:Mms19 UTSW 19 41,940,995 (GRCm39) missense possibly damaging 0.73
R1668:Mms19 UTSW 19 41,940,995 (GRCm39) missense possibly damaging 0.73
R1808:Mms19 UTSW 19 41,954,698 (GRCm39) missense probably damaging 1.00
R1827:Mms19 UTSW 19 41,942,116 (GRCm39) missense probably benign 0.00
R3055:Mms19 UTSW 19 41,938,527 (GRCm39) splice site probably benign
R3551:Mms19 UTSW 19 41,938,237 (GRCm39) missense probably benign 0.04
R3716:Mms19 UTSW 19 41,933,174 (GRCm39) missense probably damaging 1.00
R3877:Mms19 UTSW 19 41,954,695 (GRCm39) nonsense probably null
R4288:Mms19 UTSW 19 41,933,992 (GRCm39) missense probably damaging 1.00
R4289:Mms19 UTSW 19 41,933,992 (GRCm39) missense probably damaging 1.00
R4445:Mms19 UTSW 19 41,952,372 (GRCm39) missense possibly damaging 0.48
R4446:Mms19 UTSW 19 41,952,372 (GRCm39) missense possibly damaging 0.48
R4610:Mms19 UTSW 19 41,933,935 (GRCm39) missense possibly damaging 0.91
R4734:Mms19 UTSW 19 41,932,997 (GRCm39) missense probably damaging 1.00
R4748:Mms19 UTSW 19 41,932,997 (GRCm39) missense probably damaging 1.00
R5315:Mms19 UTSW 19 41,943,201 (GRCm39) missense possibly damaging 0.68
R5492:Mms19 UTSW 19 41,944,270 (GRCm39) missense possibly damaging 0.91
R5621:Mms19 UTSW 19 41,954,752 (GRCm39) missense probably benign 0.27
R5643:Mms19 UTSW 19 41,944,305 (GRCm39) missense possibly damaging 0.87
R5769:Mms19 UTSW 19 41,952,825 (GRCm39) missense probably damaging 1.00
R6567:Mms19 UTSW 19 41,938,206 (GRCm39) critical splice donor site probably null
R6569:Mms19 UTSW 19 41,952,807 (GRCm39) missense possibly damaging 0.93
R6588:Mms19 UTSW 19 41,954,715 (GRCm39) missense probably damaging 1.00
R6645:Mms19 UTSW 19 41,943,630 (GRCm39) missense probably benign 0.04
R6696:Mms19 UTSW 19 41,942,452 (GRCm39) missense probably benign 0.41
R7050:Mms19 UTSW 19 41,939,185 (GRCm39) splice site probably null
R7426:Mms19 UTSW 19 41,936,717 (GRCm39) missense probably benign
R7564:Mms19 UTSW 19 41,935,455 (GRCm39) missense probably benign 0.09
R7655:Mms19 UTSW 19 41,933,011 (GRCm39) missense probably damaging 0.98
R7656:Mms19 UTSW 19 41,933,011 (GRCm39) missense probably damaging 0.98
R7729:Mms19 UTSW 19 41,940,904 (GRCm39) nonsense probably null
R7942:Mms19 UTSW 19 41,944,400 (GRCm39) missense probably damaging 1.00
R8464:Mms19 UTSW 19 41,935,522 (GRCm39) missense probably damaging 1.00
R8681:Mms19 UTSW 19 41,937,915 (GRCm39) missense probably damaging 1.00
R8849:Mms19 UTSW 19 41,952,767 (GRCm39) missense probably damaging 1.00
R9334:Mms19 UTSW 19 41,942,203 (GRCm39) missense probably benign 0.02
R9527:Mms19 UTSW 19 41,952,830 (GRCm39) missense possibly damaging 0.68
R9714:Mms19 UTSW 19 41,935,410 (GRCm39) missense possibly damaging 0.90
Z1177:Mms19 UTSW 19 41,945,579 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCCTATGAACATGGCC -3'
(R):5'- ACAGATGAGACTTGGGTGCC -3'

Sequencing Primer
(F):5'- ATGAACATGGCCACTCTCCTGG -3'
(R):5'- GTCCCTTTCTTGGAGAGACTGATAC -3'
Posted On 2019-11-12