Incidental Mutation 'R7687:Mms19'
ID593184
Institutional Source Beutler Lab
Gene Symbol Mms19
Ensembl Gene ENSMUSG00000025159
Gene NameMMS19 (MET18 S. cerevisiae)
SynonymsMms19, 2610042O15Rik, C86341, Mms19l
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location41941086-41981157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41955168 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 417 (M417K)
Ref Sequence ENSEMBL: ENSMUSP00000130900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026168] [ENSMUST00000163287] [ENSMUST00000163398] [ENSMUST00000164776] [ENSMUST00000167820] [ENSMUST00000167927] [ENSMUST00000168484] [ENSMUST00000169775] [ENSMUST00000171561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026168
AA Change: M374K

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026168
Gene: ENSMUSG00000025159
AA Change: M374K

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.4e-29 PFAM
Pfam:MMS19_N 163 270 2.4e-44 PFAM
low complexity region 329 343 N/A INTRINSIC
Pfam:MMS19_C 484 921 4.3e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163287
AA Change: M271K

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128653
Gene: ENSMUSG00000025159
AA Change: M271K

DomainStartEndE-ValueType
Pfam:MMS19_N 3 265 9.8e-97 PFAM
Pfam:MMS19_C 381 818 1e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163398
Predicted Effect probably benign
Transcript: ENSMUST00000164776
Predicted Effect probably benign
Transcript: ENSMUST00000166090
SMART Domains Protein: ENSMUSP00000131219
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 102 494 2.2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167820
SMART Domains Protein: ENSMUSP00000130399
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_C 63 286 7.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167927
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168484
SMART Domains Protein: ENSMUSP00000126881
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169775
SMART Domains Protein: ENSMUSP00000128234
Gene: ENSMUSG00000025159

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.5e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171561
AA Change: M417K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159
AA Change: M417K

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tcp10a T A 17: 7,345,108 V433D probably damaging Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Mms19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Mms19 APN 19 41948233 missense probably benign 0.12
IGL00157:Mms19 APN 19 41945457 critical splice donor site probably null
IGL01997:Mms19 APN 19 41956531 missense probably damaging 1.00
IGL02081:Mms19 APN 19 41949979 critical splice donor site probably null
IGL02171:Mms19 APN 19 41957139 critical splice donor site probably null
IGL02306:Mms19 APN 19 41966264 missense probably damaging 1.00
IGL02678:Mms19 APN 19 41954476 missense possibly damaging 0.84
IGL02795:Mms19 APN 19 41952406 critical splice donor site probably null
IGL03233:Mms19 APN 19 41946913 splice site probably null
IGL03250:Mms19 APN 19 41954464 critical splice donor site probably null
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0480:Mms19 UTSW 19 41954846 missense probably damaging 0.98
R0498:Mms19 UTSW 19 41949773 missense possibly damaging 0.82
R0505:Mms19 UTSW 19 41953734 missense probably damaging 1.00
R0547:Mms19 UTSW 19 41963418 missense probably damaging 0.99
R1102:Mms19 UTSW 19 41950845 missense possibly damaging 0.77
R1183:Mms19 UTSW 19 41954831 missense possibly damaging 0.83
R1544:Mms19 UTSW 19 41955821 critical splice donor site probably null
R1666:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1668:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1808:Mms19 UTSW 19 41966259 missense probably damaging 1.00
R1827:Mms19 UTSW 19 41953677 missense probably benign 0.00
R3055:Mms19 UTSW 19 41950088 splice site probably benign
R3551:Mms19 UTSW 19 41949798 missense probably benign 0.04
R3716:Mms19 UTSW 19 41944735 missense probably damaging 1.00
R3877:Mms19 UTSW 19 41966256 nonsense probably null
R4288:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4289:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4445:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4446:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4610:Mms19 UTSW 19 41945496 missense possibly damaging 0.91
R4734:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R4748:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R5315:Mms19 UTSW 19 41954762 missense possibly damaging 0.68
R5492:Mms19 UTSW 19 41955831 missense possibly damaging 0.91
R5621:Mms19 UTSW 19 41966313 missense probably benign 0.27
R5643:Mms19 UTSW 19 41955866 missense possibly damaging 0.87
R5769:Mms19 UTSW 19 41964386 missense probably damaging 1.00
R6567:Mms19 UTSW 19 41949767 critical splice donor site probably null
R6569:Mms19 UTSW 19 41964368 missense possibly damaging 0.93
R6588:Mms19 UTSW 19 41966276 missense probably damaging 1.00
R6645:Mms19 UTSW 19 41955191 missense probably benign 0.04
R6696:Mms19 UTSW 19 41954013 missense probably benign 0.41
R7050:Mms19 UTSW 19 41950746 splice site probably null
R7426:Mms19 UTSW 19 41948278 missense probably benign
R7564:Mms19 UTSW 19 41947016 missense probably benign 0.09
R7655:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7656:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7729:Mms19 UTSW 19 41952465 nonsense probably null
R7942:Mms19 UTSW 19 41955961 missense probably damaging 1.00
Z1177:Mms19 UTSW 19 41957140 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCCTATGAACATGGCC -3'
(R):5'- ACAGATGAGACTTGGGTGCC -3'

Sequencing Primer
(F):5'- ATGAACATGGCCACTCTCCTGG -3'
(R):5'- GTCCCTTTCTTGGAGAGACTGATAC -3'
Posted On2019-11-12