Incidental Mutation 'R7688:Klhl12'
ID593185
Institutional Source Beutler Lab
Gene Symbol Klhl12
Ensembl Gene ENSMUSG00000026455
Gene Namekelch-like 12
SynonymsC3ip1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134455531-134491018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134489030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 497 (T497S)
Ref Sequence ENSEMBL: ENSMUSP00000027725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027725] [ENSMUST00000112232] [ENSMUST00000116528]
Predicted Effect probably benign
Transcript: ENSMUST00000027725
AA Change: T497S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027725
Gene: ENSMUSG00000026455
AA Change: T497S

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 473 3.11e-14 SMART
Kelch 474 520 1.74e-17 SMART
Kelch 521 567 4.71e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112232
AA Change: T470S

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107851
Gene: ENSMUSG00000026455
AA Change: T470S

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 493 3.39e-6 SMART
Kelch 494 540 4.71e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116528
AA Change: T497S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112227
Gene: ENSMUSG00000026455
AA Change: T497S

DomainStartEndE-ValueType
BTB 33 130 1.9e-30 SMART
BACK 135 237 5.39e-34 SMART
Kelch 282 329 1.9e-9 SMART
Kelch 330 379 3.18e-11 SMART
Kelch 380 426 1.85e-12 SMART
Kelch 427 473 3.11e-14 SMART
Kelch 474 520 1.74e-17 SMART
Kelch 521 567 4.71e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KLHL (Kelch-like) family of proteins. This protein has been identified as an autoantigen in the autoimmune disease Sjogren's syndrome and as a potential biomarker in primary biliary cirrhosis. This protein may act as a substrate adaptor of the Cullin-3 ubiquitin ligase complex to promote substrate-specific ubiquitylation. Ubiquitylation by this complex has been shown to regulate the Wnt signaling pathway as well as COPII vesicle coat size. A pseudogene has been identified on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Klhl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Klhl12 APN 1 134483753 missense probably benign
IGL01834:Klhl12 APN 1 134489420 missense probably damaging 1.00
IGL01947:Klhl12 APN 1 134463951 missense probably damaging 1.00
IGL02005:Klhl12 APN 1 134463914 missense possibly damaging 0.91
IGL02550:Klhl12 APN 1 134467705 missense possibly damaging 0.94
R0403:Klhl12 UTSW 1 134485856 missense possibly damaging 0.82
R1508:Klhl12 UTSW 1 134488974 missense possibly damaging 0.58
R1801:Klhl12 UTSW 1 134489070 missense probably damaging 1.00
R4384:Klhl12 UTSW 1 134487654 missense probably damaging 1.00
R4569:Klhl12 UTSW 1 134485769 missense probably benign 0.23
R5302:Klhl12 UTSW 1 134489451 missense possibly damaging 0.63
R5503:Klhl12 UTSW 1 134485915 critical splice donor site probably null
R5877:Klhl12 UTSW 1 134483820 nonsense probably null
R6918:Klhl12 UTSW 1 134475846 missense possibly damaging 0.46
R7126:Klhl12 UTSW 1 134467783 missense probably damaging 0.97
R7897:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7898:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7980:Klhl12 UTSW 1 134458481 missense probably benign 0.00
R7981:Klhl12 UTSW 1 134458481 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACATGTGTGCATCCCTCATC -3'
(R):5'- TTGTCTACAAGGGCCCACTC -3'

Sequencing Primer
(F):5'- ATCTCCACAGTGCAGCCGTTAG -3'
(R):5'- AGCCCCAGTGGTTGTTCC -3'
Posted On2019-11-12