Incidental Mutation 'R7688:Pfkfb3'
ID593187
Institutional Source Beutler Lab
Gene Symbol Pfkfb3
Ensembl Gene ENSMUSG00000026773
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
SynonymsE330010H22Rik, uPFK-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location11471433-11554077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11492639 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 54 (Y54H)
Ref Sequence ENSEMBL: ENSMUSP00000142296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028114] [ENSMUST00000049849] [ENSMUST00000100411] [ENSMUST00000114844] [ENSMUST00000114845] [ENSMUST00000114846] [ENSMUST00000170196] [ENSMUST00000171188] [ENSMUST00000179584] [ENSMUST00000183869] [ENSMUST00000191668] [ENSMUST00000192949] [ENSMUST00000195779]
Predicted Effect probably damaging
Transcript: ENSMUST00000028114
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028114
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049849
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050926
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.3e-110 PFAM
Pfam:KTI12 36 218 9.7e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100411
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097979
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 5.8e-110 PFAM
Pfam:KTI12 36 219 9.6e-9 PFAM
Pfam:AAA_33 37 191 2.4e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114844
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114845
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110494
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114846
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110495
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.1e-110 PFAM
Pfam:KTI12 36 219 9e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170196
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126305
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.4e-110 PFAM
Pfam:KTI12 36 218 9.9e-9 PFAM
Pfam:AAA_33 37 191 2e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171188
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179584
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137130
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183869
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138893
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191668
AA Change: Y74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142079
Gene: ENSMUSG00000026773
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.6e-110 PFAM
Pfam:KTI12 36 218 1e-8 PFAM
Pfam:AAA_33 37 191 2.1e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192949
AA Change: Y54H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142296
Gene: ENSMUSG00000026773
AA Change: Y54H

DomainStartEndE-ValueType
Pfam:6PF2K 3 226 1.9e-107 PFAM
Pfam:KTI12 16 200 3.9e-6 PFAM
Pfam:AAA_33 17 171 1.9e-8 PFAM
PGAM 228 375 3.8e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195779
AA Change: Y54H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141445
Gene: ENSMUSG00000026773
AA Change: Y54H

DomainStartEndE-ValueType
Pfam:6PF2K 3 159 1.3e-69 PFAM
Pfam:KTI12 16 212 1.8e-6 PFAM
Pfam:AAA_33 17 163 1.6e-9 PFAM
Pfam:6PF2K 158 242 2.2e-32 PFAM
Pfam:His_Phos_1 244 326 3.4e-13 PFAM
Meta Mutation Damage Score 0.5970 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before E8 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Pfkfb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pfkfb3 APN 2 11488754 missense probably damaging 1.00
IGL01651:Pfkfb3 APN 2 11489684 missense probably damaging 0.97
IGL02010:Pfkfb3 APN 2 11483994 missense probably benign
IGL02546:Pfkfb3 APN 2 11488778 missense probably damaging 1.00
IGL03182:Pfkfb3 APN 2 11501663 missense probably damaging 0.99
R1491:Pfkfb3 UTSW 2 11493936 missense probably damaging 1.00
R2365:Pfkfb3 UTSW 2 11493902 critical splice donor site probably null
R2919:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R2920:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R4709:Pfkfb3 UTSW 2 11493908 missense probably damaging 1.00
R4863:Pfkfb3 UTSW 2 11486312 missense probably benign
R4915:Pfkfb3 UTSW 2 11490298 nonsense probably null
R5087:Pfkfb3 UTSW 2 11484014 missense probably damaging 1.00
R5109:Pfkfb3 UTSW 2 11486351 splice site probably benign
R5244:Pfkfb3 UTSW 2 11484849 missense probably damaging 1.00
R5488:Pfkfb3 UTSW 2 11484669 missense probably benign 0.00
R5573:Pfkfb3 UTSW 2 11501672 missense probably benign 0.28
R5619:Pfkfb3 UTSW 2 11484659 missense probably benign 0.00
R5757:Pfkfb3 UTSW 2 11480330 missense probably damaging 0.99
R6015:Pfkfb3 UTSW 2 11481335 critical splice acceptor site probably null
R7495:Pfkfb3 UTSW 2 11482501 missense probably damaging 1.00
R7813:Pfkfb3 UTSW 2 11481908 missense probably benign 0.12
X0024:Pfkfb3 UTSW 2 11482555 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGTGCCCAAAGAACATGC -3'
(R):5'- CGGGATCTGGTTCCTAGAAGAC -3'

Sequencing Primer
(F):5'- GAACATGCAAGGTTCTCCTCTGG -3'
(R):5'- ATCTGGTTCCTAGAAGACAGCTG -3'
Posted On2019-11-12