Incidental Mutation 'R7688:Ube2j2'
ID593195
Institutional Source Beutler Lab
Gene Symbol Ube2j2
Ensembl Gene ENSMUSG00000023286
Gene Nameubiquitin-conjugating enzyme E2J 2
Synonyms1200007B18Rik, Ubc6, 5730472G04Rik, 2400008G19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location155943831-155959604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155956428 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 171 (L171I)
Ref Sequence ENSEMBL: ENSMUSP00000024056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024056] [ENSMUST00000103175] [ENSMUST00000105581] [ENSMUST00000105582] [ENSMUST00000105583] [ENSMUST00000118192] [ENSMUST00000152536] [ENSMUST00000166489]
Predicted Effect probably damaging
Transcript: ENSMUST00000024056
AA Change: L171I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024056
Gene: ENSMUSG00000023286
AA Change: L171I

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000103175
AA Change: L159I

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099464
Gene: ENSMUSG00000023286
AA Change: L159I

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105581
AA Change: L159I

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101206
Gene: ENSMUSG00000023286
AA Change: L159I

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105582
AA Change: L171I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101207
Gene: ENSMUSG00000023286
AA Change: L171I

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105583
AA Change: L171I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101208
Gene: ENSMUSG00000023286
AA Change: L171I

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000118192
SMART Domains Protein: ENSMUSP00000112785
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 15 153 5.28e-27 SMART
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152536
AA Change: L107I

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114235
Gene: ENSMUSG00000023286
AA Change: L107I

DomainStartEndE-ValueType
UBCc 2 117 5.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166489
AA Change: L159I

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127712
Gene: ENSMUSG00000023286
AA Change: L159I

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Ube2j2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ube2j2 APN 4 155956447 missense possibly damaging 0.79
IGL00951:Ube2j2 APN 4 155946377 intron probably benign
IGL00953:Ube2j2 APN 4 155946377 intron probably benign
IGL01732:Ube2j2 APN 4 155957331 missense probably damaging 1.00
IGL02709:Ube2j2 APN 4 155957331 missense probably damaging 1.00
R1903:Ube2j2 UTSW 4 155949026 missense probably benign 0.13
R4172:Ube2j2 UTSW 4 155949086 missense probably damaging 1.00
R4630:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4632:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4999:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5000:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5249:Ube2j2 UTSW 4 155949058 missense possibly damaging 0.85
R7225:Ube2j2 UTSW 4 155949316 intron probably null
R7436:Ube2j2 UTSW 4 155957331 missense probably damaging 1.00
R7995:Ube2j2 UTSW 4 155957338 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGACACAGAACATGTTTCCTG -3'
(R):5'- AACAAGGAGGGCCTGCAATC -3'

Sequencing Primer
(F):5'- ATAGGCTGGCATTGAATCTCAGC -3'
(R):5'- GAGGGCCTGCAATCCCACTAC -3'
Posted On2019-11-12