Incidental Mutation 'R7688:Pdcl2'
ID593197
Institutional Source Beutler Lab
Gene Symbol Pdcl2
Ensembl Gene ENSMUSG00000029235
Gene Namephosducin-like 2
Synonyms1700010B22Rik, 1700016K07Rik, Mgcphlp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76312115-76331156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76317923 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 150 (N150S)
Ref Sequence ENSEMBL: ENSMUSP00000031145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031145] [ENSMUST00000122213]
PDB Structure
Solution structure of the Thioredoxin-like domain of Phosducin-like protein 2(PDCL2) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031145
AA Change: N150S

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031145
Gene: ENSMUSG00000029235
AA Change: N150S

DomainStartEndE-ValueType
Pfam:Phosducin 8 208 3.8e-20 PFAM
low complexity region 229 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122213
AA Change: N102S

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113699
Gene: ENSMUSG00000029235
AA Change: N102S

DomainStartEndE-ValueType
Pfam:Phosducin 1 178 2.3e-19 PFAM
low complexity region 181 188 N/A INTRINSIC
Meta Mutation Damage Score 0.0821 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosducin-like protein family and is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin. Members of the phosducin-like protein family have been shown to bind to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Pdcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Pdcl2 APN 5 76325112 missense probably damaging 1.00
IGL00796:Pdcl2 APN 5 76319175 missense probably damaging 0.99
IGL02310:Pdcl2 APN 5 76317881 missense probably damaging 1.00
IGL02332:Pdcl2 APN 5 76319135 nonsense probably null
IGL02562:Pdcl2 APN 5 76319191 missense probably damaging 1.00
R0288:Pdcl2 UTSW 5 76312497 missense possibly damaging 0.80
R0606:Pdcl2 UTSW 5 76312481 missense probably benign
R2070:Pdcl2 UTSW 5 76324991 critical splice donor site probably null
R6384:Pdcl2 UTSW 5 76331008 splice site probably null
R7055:Pdcl2 UTSW 5 76317924 missense probably benign 0.00
R7414:Pdcl2 UTSW 5 76312512 missense possibly damaging 0.74
R7638:Pdcl2 UTSW 5 76317828 missense probably damaging 1.00
R7718:Pdcl2 UTSW 5 76317999 missense probably damaging 1.00
R7766:Pdcl2 UTSW 5 76317896 missense probably benign 0.00
Z1177:Pdcl2 UTSW 5 76317932 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCATGACAGGAGGACATCAC -3'
(R):5'- CTTTGTTAAAGGTCACAGCACAAGAC -3'

Sequencing Primer
(F):5'- ACCCTGGGCATGAACATTG -3'
(R):5'- GCAAAGATCTATATTGTGCAAAAGAG -3'
Posted On2019-11-12