Incidental Mutation 'R7688:Fam13a'
ID593201
Institutional Source Beutler Lab
Gene Symbol Fam13a
Ensembl Gene ENSMUSG00000037709
Gene Namefamily with sequence similarity 13, member A
SynonymsD430015B01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location58932090-59024549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58935707 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 654 (V654I)
Ref Sequence ENSEMBL: ENSMUSP00000087304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089860] [ENSMUST00000173193]
Predicted Effect probably benign
Transcript: ENSMUST00000089860
AA Change: V654I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000087304
Gene: ENSMUSG00000037709
AA Change: V654I

DomainStartEndE-ValueType
Blast:RhoGAP 19 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 620 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173193
AA Change: V626I

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134135
Gene: ENSMUSG00000037709
AA Change: V626I

DomainStartEndE-ValueType
Blast:RhoGAP 21 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 592 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Fam13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Fam13a APN 6 58946126 missense probably benign 0.03
IGL00467:Fam13a APN 6 58940113 splice site probably benign
IGL01288:Fam13a APN 6 58956727 missense probably damaging 1.00
IGL01503:Fam13a APN 6 58956080 missense probably damaging 1.00
IGL01532:Fam13a APN 6 58940295 missense probably damaging 0.96
IGL02197:Fam13a APN 6 58935601 missense possibly damaging 0.65
IGL02206:Fam13a APN 6 58987219 missense probably benign 0.00
IGL03189:Fam13a APN 6 58956858 missense probably damaging 0.99
BB009:Fam13a UTSW 6 58983888 critical splice donor site probably null
BB019:Fam13a UTSW 6 58983888 critical splice donor site probably null
R0361:Fam13a UTSW 6 58987174 missense probably benign
R0512:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R0801:Fam13a UTSW 6 58984012 missense probably benign 0.01
R1222:Fam13a UTSW 6 58935722 splice site probably benign
R1378:Fam13a UTSW 6 58956751 missense probably benign 0.04
R1535:Fam13a UTSW 6 58939347 missense probably damaging 0.99
R1614:Fam13a UTSW 6 58940184 missense probably damaging 1.00
R1663:Fam13a UTSW 6 58954372 nonsense probably null
R1809:Fam13a UTSW 6 58965060 critical splice donor site probably null
R1905:Fam13a UTSW 6 58953490 missense probably damaging 1.00
R2568:Fam13a UTSW 6 58935609 missense probably damaging 1.00
R3771:Fam13a UTSW 6 58987186 missense probably benign 0.11
R4654:Fam13a UTSW 6 58987167 missense probably benign
R5244:Fam13a UTSW 6 58953474 nonsense probably null
R5488:Fam13a UTSW 6 59024318 missense probably null 1.00
R5489:Fam13a UTSW 6 59024318 missense probably null 1.00
R5712:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R5729:Fam13a UTSW 6 58939307 missense probably damaging 0.99
R5969:Fam13a UTSW 6 58965198 missense probably damaging 1.00
R6074:Fam13a UTSW 6 58989738 splice site probably null
R6275:Fam13a UTSW 6 58954257 missense probably damaging 0.98
R6306:Fam13a UTSW 6 58940254 missense probably benign 0.02
R6338:Fam13a UTSW 6 58953499 missense probably damaging 1.00
R6603:Fam13a UTSW 6 58987189 missense probably benign 0.31
R7508:Fam13a UTSW 6 58987284 missense probably damaging 1.00
R7516:Fam13a UTSW 6 58955263 missense probably damaging 1.00
R7728:Fam13a UTSW 6 58954299 missense possibly damaging 0.79
R7932:Fam13a UTSW 6 58983888 critical splice donor site probably null
R8080:Fam13a UTSW 6 58956805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGTACAGCTCCAAGGC -3'
(R):5'- CTCAAGTTGCATGGAACCTCC -3'

Sequencing Primer
(F):5'- TCCAAGGCTGCCTTCCAGAG -3'
(R):5'- CAGAAAAGAACCACTTTGCACTTGTC -3'
Posted On2019-11-12