Incidental Mutation 'R7688:Tigd2'
ID593202
Institutional Source Beutler Lab
Gene Symbol Tigd2
Ensembl Gene ENSMUSG00000049232
Gene Nametigger transposable element derived 2
Synonyms3632410O17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location59208870-59212033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59210397 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 83 (M83K)
Ref Sequence ENSEMBL: ENSMUSP00000057223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062626]
Predicted Effect probably damaging
Transcript: ENSMUST00000062626
AA Change: M83K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057223
Gene: ENSMUSG00000049232
AA Change: M83K

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-17 PFAM
CENPB 73 139 5.78e-19 SMART
Pfam:DDE_1 206 385 2.2e-52 PFAM
low complexity region 504 519 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Tigd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Tigd2 APN 6 59211698 nonsense probably null
IGL03356:Tigd2 APN 6 59211705 missense probably benign 0.04
PIT1430001:Tigd2 UTSW 6 59211248 missense probably damaging 1.00
R0048:Tigd2 UTSW 6 59211384 missense possibly damaging 0.86
R0387:Tigd2 UTSW 6 59211158 missense probably benign 0.00
R0523:Tigd2 UTSW 6 59210373 missense probably benign 0.30
R0636:Tigd2 UTSW 6 59211287 missense possibly damaging 0.66
R1171:Tigd2 UTSW 6 59211376 missense possibly damaging 0.73
R2440:Tigd2 UTSW 6 59209995 start gained probably benign
R4327:Tigd2 UTSW 6 59210577 missense probably benign 0.36
R4731:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4732:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4733:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R5005:Tigd2 UTSW 6 59211146 missense probably benign 0.06
R5028:Tigd2 UTSW 6 59211220 nonsense probably null
R5248:Tigd2 UTSW 6 59211153 missense probably damaging 1.00
R6006:Tigd2 UTSW 6 59210777 missense possibly damaging 0.45
R7099:Tigd2 UTSW 6 59210181 missense probably damaging 1.00
R7261:Tigd2 UTSW 6 59211067 missense probably benign 0.02
R7553:Tigd2 UTSW 6 59211579 missense probably benign 0.04
R8002:Tigd2 UTSW 6 59210509 missense probably damaging 1.00
Z1177:Tigd2 UTSW 6 59211530 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAAACGTGTGGTCCTGACAATTAAAG -3'
(R):5'- AGCCTTTGGAATACCGTGGC -3'

Sequencing Primer
(F):5'- GTGGTCCTGACAATTAAAGACAAAC -3'
(R):5'- TGGCGCTGCTTAAACCTAGTAAG -3'
Posted On2019-11-12