Incidental Mutation 'R7688:Tas2r115'
ID593203
Institutional Source Beutler Lab
Gene Symbol Tas2r115
Ensembl Gene ENSMUSG00000071149
Gene Nametaste receptor, type 2, member 115
SynonymsmGR15, T2R15, Tas2r15, mt2r49
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132737003-132738035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132737680 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 103 (S103C)
Ref Sequence ENSEMBL: ENSMUSP00000093043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095394]
Predicted Effect probably damaging
Transcript: ENSMUST00000095394
AA Change: S103C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093043
Gene: ENSMUSG00000071149
AA Change: S103C

DomainStartEndE-ValueType
Pfam:TAS2R 1 299 2.2e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Tas2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Tas2r115 APN 6 132737778 missense probably benign 0.11
IGL01285:Tas2r115 APN 6 132737678 missense probably damaging 1.00
IGL01516:Tas2r115 APN 6 132737613 missense probably damaging 0.98
IGL01637:Tas2r115 APN 6 132737629 missense probably damaging 0.99
IGL02041:Tas2r115 APN 6 132737467 missense probably benign 0.13
IGL02178:Tas2r115 APN 6 132737308 missense probably benign 0.11
R0467:Tas2r115 UTSW 6 132737719 missense probably benign 0.02
R0553:Tas2r115 UTSW 6 132737959 missense probably benign 0.18
R1425:Tas2r115 UTSW 6 132737479 missense probably benign 0.02
R1770:Tas2r115 UTSW 6 132737971 missense probably damaging 1.00
R2120:Tas2r115 UTSW 6 132737507 missense possibly damaging 0.51
R2136:Tas2r115 UTSW 6 132737346 missense probably damaging 0.99
R2141:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R2142:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R4479:Tas2r115 UTSW 6 132737532 missense probably damaging 0.98
R4687:Tas2r115 UTSW 6 132737284 missense possibly damaging 0.80
R4948:Tas2r115 UTSW 6 132737161 missense probably damaging 1.00
R5097:Tas2r115 UTSW 6 132737253 missense probably damaging 1.00
R5856:Tas2r115 UTSW 6 132737538 missense possibly damaging 0.86
R6927:Tas2r115 UTSW 6 132737932 missense probably damaging 1.00
R7473:Tas2r115 UTSW 6 132737251 missense probably damaging 1.00
Z1088:Tas2r115 UTSW 6 132737081 nonsense probably null
Z1176:Tas2r115 UTSW 6 132737856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTTCCATAGATCCAGACATC -3'
(R):5'- TCATAGCTCTGGTACAATGCATG -3'

Sequencing Primer
(F):5'- GTTCCATAGATCCAGACATCAATATG -3'
(R):5'- GAGAAGAACGTTCCCTTCAGCAG -3'
Posted On2019-11-12