Incidental Mutation 'R7688:Vmn2r72'
ID593206
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85754890 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 31 (D31V)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: D31V

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: D31V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 synonymous probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R7926:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCAGAAGACACATGGTATC -3'
(R):5'- AAATAGTGTCACCTGGATGGG -3'

Sequencing Primer
(F):5'- CTTCTTGTCTAGATTCCAACTG -3'
(R):5'- AAATAGTGTCACCTGGATGGGTTCAC -3'
Posted On2019-11-12