Incidental Mutation 'R0240:Dpy19l2'
ID 59321
Institutional Source Beutler Lab
Gene Symbol Dpy19l2
Ensembl Gene ENSMUSG00000085576
Gene Name dpy-19 like 2
Synonyms 4932443J21Rik
MMRRC Submission 038478-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R0240 (G1)
Quality Score 186
Status Validated
Chromosome 9
Chromosomal Location 24468343-24607589 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 24569876 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 359 (A359D)
Ref Sequence ENSEMBL: ENSMUSP00000132092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133010]
AlphaFold P0CW70
Predicted Effect probably damaging
Transcript: ENSMUST00000133010
AA Change: A359D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132092
Gene: ENSMUSG00000085576
AA Change: A359D

DomainStartEndE-ValueType
Pfam:Dpy19 129 772 3.1e-233 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility associated with globozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 123,506,920 (GRCm39) L71P probably damaging Het
Adamts2 A T 11: 50,666,201 (GRCm39) D399V probably damaging Het
Adck2 T A 6: 39,560,752 (GRCm39) V380E probably benign Het
Alg11 T A 8: 22,555,468 (GRCm39) V243D possibly damaging Het
Ankrd27 T A 7: 35,318,864 (GRCm39) L585Q probably damaging Het
Armh4 A G 14: 50,005,859 (GRCm39) probably benign Het
Atp7a T A X: 105,153,447 (GRCm39) N1117K probably damaging Het
Bltp3a T A 17: 28,114,844 (GRCm39) probably benign Het
Cacna1b G A 2: 24,528,669 (GRCm39) probably benign Het
Cacna1d T A 14: 29,818,926 (GRCm39) M1210L probably benign Het
Cacna1s T C 1: 136,001,234 (GRCm39) probably benign Het
Chd7 T C 4: 8,852,670 (GRCm39) probably benign Het
Col12a1 A T 9: 79,559,315 (GRCm39) S1858T probably benign Het
Cotl1 C T 8: 120,567,063 (GRCm39) W26* probably null Het
Csmd3 T C 15: 47,492,635 (GRCm39) T3000A probably benign Het
Dcp1a T A 14: 30,206,551 (GRCm39) probably benign Het
Ddhd2 A T 8: 26,229,617 (GRCm39) probably null Het
Dnah8 T C 17: 30,984,653 (GRCm39) I3117T probably damaging Het
Dnm3 G T 1: 162,181,194 (GRCm39) Q162K probably benign Het
Ece1 T A 4: 137,676,746 (GRCm39) probably benign Het
Eif4g3 A G 4: 137,897,873 (GRCm39) K1025R probably damaging Het
Eml2 C A 7: 18,918,797 (GRCm39) Y82* probably null Het
Eml6 A G 11: 29,742,367 (GRCm39) V1057A possibly damaging Het
Eral1 A G 11: 77,966,884 (GRCm39) probably benign Het
Espl1 T C 15: 102,220,976 (GRCm39) S911P probably benign Het
Fbxo8 A G 8: 57,043,296 (GRCm39) probably benign Het
Flrt1 A T 19: 7,074,475 (GRCm39) probably benign Het
Fndc7 A G 3: 108,766,235 (GRCm39) probably benign Het
G3bp1 G A 11: 55,382,854 (GRCm39) G139D probably damaging Het
Gabra6 C T 11: 42,205,774 (GRCm39) V351I probably benign Het
Galc A T 12: 98,218,293 (GRCm39) H186Q probably damaging Het
Ganab A G 19: 8,890,177 (GRCm39) D702G possibly damaging Het
Hdac10 T C 15: 89,010,085 (GRCm39) E291G possibly damaging Het
Hectd3 T G 4: 116,859,810 (GRCm39) V749G probably damaging Het
Kash5 C T 7: 44,849,675 (GRCm39) A83T probably benign Het
Kcnh1 T A 1: 192,187,648 (GRCm39) I703N probably benign Het
Kcnma1 G A 14: 23,544,647 (GRCm39) T505I probably damaging Het
Kctd11 A G 11: 69,770,640 (GRCm39) C133R probably damaging Het
Lama3 A T 18: 12,672,880 (GRCm39) probably null Het
Lamb3 T C 1: 193,017,335 (GRCm39) L842P probably damaging Het
Ldlr T C 9: 21,649,295 (GRCm39) probably benign Het
Lipk G A 19: 34,024,210 (GRCm39) R336H probably benign Het
Lrrc24 T A 15: 76,607,409 (GRCm39) D58V probably damaging Het
Lrsam1 A G 2: 32,845,197 (GRCm39) L106P probably damaging Het
Milr1 G A 11: 106,645,722 (GRCm39) W88* probably null Het
Mmp10 A G 9: 7,506,544 (GRCm39) D340G probably damaging Het
Mybpc1 T A 10: 88,391,600 (GRCm39) Y285F possibly damaging Het
Ncoa3 A G 2: 165,896,320 (GRCm39) T408A probably benign Het
Nefm T A 14: 68,358,583 (GRCm39) K484* probably null Het
Nfasc A G 1: 132,529,721 (GRCm39) S814P probably damaging Het
Nlrp4a T C 7: 26,161,941 (GRCm39) V863A probably benign Het
Nos1 C T 5: 118,005,948 (GRCm39) P223S probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Or13c7 T A 4: 43,854,512 (GRCm39) S68T probably damaging Het
Or4c108 A T 2: 88,803,740 (GRCm39) L165Q probably damaging Het
Or5an6 A T 19: 12,372,327 (GRCm39) E233D probably benign Het
Or8k41 A G 2: 86,313,730 (GRCm39) S119P possibly damaging Het
Osbpl5 T C 7: 143,295,406 (GRCm39) probably null Het
Otog C A 7: 45,913,456 (GRCm39) probably null Het
Pacs1 A T 19: 5,206,402 (GRCm39) I261N possibly damaging Het
Pbx1 G A 1: 168,031,051 (GRCm39) T189I possibly damaging Het
Pcnx1 T C 12: 81,993,792 (GRCm39) I908T possibly damaging Het
Pdxdc1 A T 16: 13,697,309 (GRCm39) W124R probably damaging Het
Phex C A X: 155,969,214 (GRCm39) D587Y probably damaging Het
Plcb3 A T 19: 6,940,363 (GRCm39) D435E probably benign Het
Plce1 A C 19: 38,717,330 (GRCm39) K1373T probably damaging Het
Prkcd G A 14: 30,324,045 (GRCm39) A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 (GRCm39) S421T probably benign Het
Ptprs T C 17: 56,743,087 (GRCm39) probably null Het
Qrich1 A G 9: 108,411,333 (GRCm39) D286G probably damaging Het
Rcc1 C A 4: 132,060,226 (GRCm39) G393V probably damaging Het
Reln T C 5: 22,311,043 (GRCm39) N290S probably benign Het
Rgl1 T C 1: 152,430,175 (GRCm39) probably benign Het
Rhpn1 C T 15: 75,585,971 (GRCm39) T628I probably benign Het
Rilp A G 11: 75,401,747 (GRCm39) R176G probably benign Het
Riok3 C T 18: 12,288,284 (GRCm39) A487V probably benign Het
Rnf224 T C 2: 25,126,219 (GRCm39) T45A probably damaging Het
Rpa1 A G 11: 75,219,513 (GRCm39) V137A probably benign Het
Rps6ka1 C A 4: 133,575,842 (GRCm39) Q693H probably benign Het
Scn2a G T 2: 65,566,118 (GRCm39) V1381F probably benign Het
Scp2 T A 4: 107,955,275 (GRCm39) H112L probably benign Het
Sdk1 T C 5: 141,984,502 (GRCm39) W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 (GRCm39) V408F probably damaging Het
Slc28a2 T A 2: 122,285,008 (GRCm39) I332N probably benign Het
Slc37a3 A G 6: 39,314,172 (GRCm39) V480A probably benign Het
Slc45a4 T A 15: 73,453,755 (GRCm39) E674D probably benign Het
Smpd3 T C 8: 106,991,788 (GRCm39) E255G probably damaging Het
Snx29 C T 16: 11,478,417 (GRCm39) R658W probably damaging Het
Sppl2a A T 2: 126,762,256 (GRCm39) M275K probably benign Het
Stac T C 9: 111,464,089 (GRCm39) N59S probably damaging Het
Stk25 A T 1: 93,554,782 (GRCm39) L131Q probably damaging Het
Tep1 C T 14: 51,100,486 (GRCm39) probably benign Het
Thbs1 C A 2: 117,944,874 (GRCm39) N229K probably damaging Het
Tmx2 A T 2: 84,506,186 (GRCm39) H89Q probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tradd T C 8: 105,985,924 (GRCm39) N209S possibly damaging Het
Trappc3l A T 10: 33,974,928 (GRCm39) R119* probably null Het
Trmt1l G A 1: 151,333,205 (GRCm39) probably benign Het
Ublcp1 G T 11: 44,349,104 (GRCm39) Y243* probably null Het
Usp24 C A 4: 106,271,601 (GRCm39) C2158* probably null Het
Usp34 A T 11: 23,383,206 (GRCm39) K2088N probably damaging Het
Vmn1r53 G C 6: 90,200,925 (GRCm39) S133C probably damaging Het
Vmn2r52 A G 7: 9,893,327 (GRCm39) V604A probably damaging Het
Vmn2r93 A G 17: 18,525,061 (GRCm39) K240E probably benign Het
Wdr13 T G X: 7,994,284 (GRCm39) D242A probably damaging Het
Wwp1 C T 4: 19,641,734 (GRCm39) probably null Het
Zan G A 5: 137,396,624 (GRCm39) H4311Y unknown Het
Zc3h12c C A 9: 52,055,383 (GRCm39) R123L possibly damaging Het
Zfp125 A T 12: 20,950,562 (GRCm39) noncoding transcript Het
Zfp318 C T 17: 46,707,739 (GRCm39) P266S probably benign Het
Other mutations in Dpy19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Dpy19l2 APN 9 24,494,114 (GRCm39) missense probably damaging 1.00
IGL01137:Dpy19l2 APN 9 24,569,858 (GRCm39) missense possibly damaging 0.78
IGL01586:Dpy19l2 APN 9 24,578,271 (GRCm39) missense probably benign 0.16
IGL02245:Dpy19l2 APN 9 24,607,321 (GRCm39) missense probably benign
IGL02507:Dpy19l2 APN 9 24,542,563 (GRCm39) missense probably benign 0.01
IGL02541:Dpy19l2 APN 9 24,569,943 (GRCm39) missense probably benign 0.00
IGL02644:Dpy19l2 APN 9 24,569,888 (GRCm39) missense probably damaging 1.00
IGL03144:Dpy19l2 APN 9 24,557,603 (GRCm39) missense possibly damaging 0.92
Deferential UTSW 9 24,607,110 (GRCm39) missense probably benign 0.41
polite UTSW 9 24,572,039 (GRCm39) missense possibly damaging 0.91
BB004:Dpy19l2 UTSW 9 24,607,197 (GRCm39) missense probably benign 0.00
BB014:Dpy19l2 UTSW 9 24,607,197 (GRCm39) missense probably benign 0.00
R0022:Dpy19l2 UTSW 9 24,607,420 (GRCm39) missense probably benign
R0029:Dpy19l2 UTSW 9 24,469,397 (GRCm39) missense probably damaging 0.97
R0066:Dpy19l2 UTSW 9 24,557,679 (GRCm39) splice site probably benign
R0066:Dpy19l2 UTSW 9 24,557,679 (GRCm39) splice site probably benign
R0089:Dpy19l2 UTSW 9 24,607,089 (GRCm39) missense probably benign 0.01
R0240:Dpy19l2 UTSW 9 24,569,876 (GRCm39) missense probably damaging 1.00
R0349:Dpy19l2 UTSW 9 24,607,218 (GRCm39) missense possibly damaging 0.89
R0491:Dpy19l2 UTSW 9 24,607,324 (GRCm39) missense probably benign 0.09
R0519:Dpy19l2 UTSW 9 24,469,391 (GRCm39) missense probably benign 0.30
R1398:Dpy19l2 UTSW 9 24,492,559 (GRCm39) splice site probably benign
R1465:Dpy19l2 UTSW 9 24,580,618 (GRCm39) missense probably benign 0.04
R1465:Dpy19l2 UTSW 9 24,580,618 (GRCm39) missense probably benign 0.04
R1576:Dpy19l2 UTSW 9 24,495,798 (GRCm39) missense probably benign
R1606:Dpy19l2 UTSW 9 24,492,511 (GRCm39) missense probably benign
R2157:Dpy19l2 UTSW 9 24,592,076 (GRCm39) missense probably benign 0.02
R2157:Dpy19l2 UTSW 9 24,495,928 (GRCm39) missense probably benign 0.00
R2402:Dpy19l2 UTSW 9 24,492,544 (GRCm39) missense probably damaging 1.00
R2409:Dpy19l2 UTSW 9 24,569,924 (GRCm39) missense probably benign 0.00
R3196:Dpy19l2 UTSW 9 24,607,285 (GRCm39) missense probably damaging 1.00
R3419:Dpy19l2 UTSW 9 24,492,501 (GRCm39) missense probably damaging 1.00
R4884:Dpy19l2 UTSW 9 24,539,476 (GRCm39) nonsense probably null
R5289:Dpy19l2 UTSW 9 24,607,293 (GRCm39) missense probably benign
R5950:Dpy19l2 UTSW 9 24,492,430 (GRCm39) missense probably benign 0.10
R6470:Dpy19l2 UTSW 9 24,572,039 (GRCm39) missense possibly damaging 0.91
R7028:Dpy19l2 UTSW 9 24,539,547 (GRCm39) missense probably benign 0.15
R7051:Dpy19l2 UTSW 9 24,495,789 (GRCm39) missense probably benign 0.00
R7095:Dpy19l2 UTSW 9 24,607,110 (GRCm39) missense probably benign 0.41
R7649:Dpy19l2 UTSW 9 24,607,459 (GRCm39) start codon destroyed probably null 0.53
R7927:Dpy19l2 UTSW 9 24,607,197 (GRCm39) missense probably benign 0.00
R7936:Dpy19l2 UTSW 9 24,469,454 (GRCm39) missense probably damaging 1.00
R8076:Dpy19l2 UTSW 9 24,591,988 (GRCm39) missense probably damaging 1.00
R8259:Dpy19l2 UTSW 9 24,580,702 (GRCm39) missense probably benign 0.08
R8473:Dpy19l2 UTSW 9 24,492,526 (GRCm39) missense probably benign
R9493:Dpy19l2 UTSW 9 24,530,459 (GRCm39) missense probably damaging 1.00
X0067:Dpy19l2 UTSW 9 24,496,833 (GRCm39) missense probably benign 0.00
Z1088:Dpy19l2 UTSW 9 24,572,120 (GRCm39) splice site probably null
Z1177:Dpy19l2 UTSW 9 24,557,655 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTGCCATAAAACGTTATCACTTTGCCC -3'
(R):5'- CAAGGACTCCTTTGTCTTGAGTTACTGG -3'

Sequencing Primer
(F):5'- gttgcctctgttacccctg -3'
(R):5'- CTGGCTATCTTTACAGCAGAAC -3'
Posted On 2013-07-11