Incidental Mutation 'R7688:Slc22a18'
ID593210
Institutional Source Beutler Lab
Gene Symbol Slc22a18
Ensembl Gene ENSMUSG00000000154
Gene Namesolute carrier family 22 (organic cation transporter), member 18
Synonymsp45-BWR1A, Impt1, BWSCR1A, Orctl2, BWR1A, Slc22a1l, IMPT1, TSSC5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143473736-143499334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143479823 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 104 (G104S)
Ref Sequence ENSEMBL: ENSMUSP00000056082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052348] [ENSMUST00000105917] [ENSMUST00000141988] [ENSMUST00000145943] [ENSMUST00000150791]
Predicted Effect probably damaging
Transcript: ENSMUST00000052348
AA Change: G104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056082
Gene: ENSMUSG00000000154
AA Change: G104S

DomainStartEndE-ValueType
Pfam:MFS_1 14 339 1.1e-31 PFAM
Pfam:MFS_1 229 410 5.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105917
AA Change: G104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101537
Gene: ENSMUSG00000000154
AA Change: G104S

DomainStartEndE-ValueType
Pfam:MFS_1 14 337 7.8e-32 PFAM
Pfam:MFS_3 66 346 6.5e-9 PFAM
Pfam:MFS_1 229 410 3.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141988
Predicted Effect probably benign
Transcript: ENSMUST00000145943
SMART Domains Protein: ENSMUSP00000115345
Gene: ENSMUSG00000000154

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150791
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is imprinted, with preferential expression from the maternal allele. Mutations in this gene have been found in Wilms' tumor and lung cancer. This protein may act as a transporter of organic cations, and have a role in the transport of chloroquine and quinidine-related compounds in kidney. Several alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Slc22a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Slc22a18 APN 7 143499100 missense probably damaging 1.00
IGL01888:Slc22a18 APN 7 143479316 missense probably damaging 1.00
IGL02458:Slc22a18 APN 7 143492837 splice site probably benign
IGL02626:Slc22a18 APN 7 143499100 missense probably damaging 1.00
PIT4810001:Slc22a18 UTSW 7 143492931 missense probably benign 0.00
R0294:Slc22a18 UTSW 7 143492841 critical splice acceptor site probably null
R0571:Slc22a18 UTSW 7 143491861 splice site probably benign
R1951:Slc22a18 UTSW 7 143476247 missense probably damaging 1.00
R1953:Slc22a18 UTSW 7 143476247 missense probably damaging 1.00
R2352:Slc22a18 UTSW 7 143497415 missense probably benign 0.02
R3900:Slc22a18 UTSW 7 143479770 missense probably damaging 1.00
R5317:Slc22a18 UTSW 7 143499159 missense probably damaging 1.00
R5428:Slc22a18 UTSW 7 143479345 missense probably damaging 1.00
R7672:Slc22a18 UTSW 7 143490820 missense probably damaging 1.00
R7684:Slc22a18 UTSW 7 143490840 missense probably benign 0.00
R8130:Slc22a18 UTSW 7 143499174 missense probably damaging 1.00
Z1177:Slc22a18 UTSW 7 143497042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTTCACCAGCATCTCAG -3'
(R):5'- AGTACCTCCATTCAGGCCAC -3'

Sequencing Primer
(F):5'- TCTCAGCCTACCAGCAGG -3'
(R):5'- CTGGAATTCACTCTGTAGACCAGG -3'
Posted On2019-11-12