Incidental Mutation 'R7688:F11'
ID593212
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Namecoagulation factor XI
SynonymsFXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45241174-45262031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45250090 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 188 (F188I)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
Predicted Effect probably damaging
Transcript: ENSMUST00000034064
AA Change: F188I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: F188I

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0225:F11 UTSW 8 45249077 missense probably benign 0.00
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2273:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2318:F11 UTSW 8 45248638 missense probably damaging 1.00
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2403:F11 UTSW 8 45248638 missense probably damaging 1.00
R2510:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2893:F11 UTSW 8 45248638 missense probably damaging 1.00
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6213:F11 UTSW 8 45241500 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
R8064:F11 UTSW 8 45245773 missense probably benign 0.01
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCCAGGACATAGTGAACCATTTC -3'
(R):5'- GTTAGAAGAGCTGCCAGGAC -3'

Sequencing Primer
(F):5'- TGAACCATTTCACTTTGAAGACAG -3'
(R):5'- TGAACACTCCTGGGCAGTTC -3'
Posted On2019-11-12