Incidental Mutation 'R7688:Cldn24'
ID593213
Institutional Source Beutler Lab
Gene Symbol Cldn24
Ensembl Gene ENSMUSG00000061974
Gene Nameclaudin 24
SynonymsGm10107
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location47822143-47822805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47822705 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 188 (C188Y)
Ref Sequence ENSEMBL: ENSMUSP00000078584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038693] [ENSMUST00000057561] [ENSMUST00000079639]
Predicted Effect probably benign
Transcript: ENSMUST00000038693
SMART Domains Protein: ENSMUSP00000041676
Gene: ENSMUSG00000038064

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 6.2e-23 PFAM
Pfam:Claudin_2 18 184 1.8e-9 PFAM
low complexity region 185 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057561
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079639
AA Change: C188Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078584
Gene: ENSMUSG00000061974
AA Change: C188Y

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 9.1e-25 PFAM
Pfam:Claudin_2 18 184 2.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is 75% identical to the human homolog. Similar to the human gene, this gene is upstream of the Cldn22 gene, which overlaps the Wwc2 gene on the opposite strand. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Cldn24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2252:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R2253:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R2309:Cldn24 UTSW 8 47822739 nonsense probably null
R6265:Cldn24 UTSW 8 47822339 missense probably benign 0.00
R6818:Cldn24 UTSW 8 47822722 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTCATGGTGCTAGTTCCTGTC -3'
(R):5'- TTGGACAATCCCCAGCATAC -3'

Sequencing Primer
(F):5'- GCTAGTTCCTGTCTCCTGGG -3'
(R):5'- TTTCCACACATAGCTATGCAATG -3'
Posted On2019-11-12