Incidental Mutation 'R7688:Zfp317'
ID593214
Institutional Source Beutler Lab
Gene Symbol Zfp317
Ensembl Gene ENSMUSG00000057551
Gene Namezinc finger protein 317
SynonymsZfp67, KRAB9, Zfp75, D230022C05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location19622102-19649731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19647955 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 488 (H488Q)
Ref Sequence ENSEMBL: ENSMUSP00000151161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079042] [ENSMUST00000208694] [ENSMUST00000213725] [ENSMUST00000215372]
Predicted Effect probably null
Transcript: ENSMUST00000079042
AA Change: H577Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078051
Gene: ENSMUSG00000057551
AA Change: H577Q

DomainStartEndE-ValueType
KRAB 60 120 4.58e-32 SMART
ZnF_C2H2 223 245 1.79e-2 SMART
ZnF_C2H2 251 273 6.88e-4 SMART
ZnF_C2H2 279 301 2.24e-3 SMART
ZnF_C2H2 307 329 1.1e-2 SMART
ZnF_C2H2 335 357 7.37e-4 SMART
ZnF_C2H2 363 385 8.47e-4 SMART
ZnF_C2H2 391 413 1.3e-4 SMART
ZnF_C2H2 419 441 3.63e-3 SMART
ZnF_C2H2 447 469 3.34e-2 SMART
ZnF_C2H2 475 497 4.47e-3 SMART
ZnF_C2H2 503 525 9.73e-4 SMART
ZnF_C2H2 531 553 5.9e-3 SMART
ZnF_C2H2 559 581 1.72e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000208694
AA Change: H577Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000213725
AA Change: H488Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215372
AA Change: H577Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Other mutations in Zfp317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02425:Zfp317 APN 9 19643613 nonsense probably null
R1520:Zfp317 UTSW 9 19647848 missense possibly damaging 0.95
R1646:Zfp317 UTSW 9 19647312 missense probably damaging 1.00
R1860:Zfp317 UTSW 9 19641984 missense possibly damaging 0.85
R2029:Zfp317 UTSW 9 19645236 missense probably benign 0.13
R2364:Zfp317 UTSW 9 19647735 missense probably benign 0.01
R4006:Zfp317 UTSW 9 19648037 missense possibly damaging 0.82
R4031:Zfp317 UTSW 9 19646712 missense possibly damaging 0.53
R4293:Zfp317 UTSW 9 19646694 splice site probably null
R4897:Zfp317 UTSW 9 19646847 missense probably benign 0.28
R5593:Zfp317 UTSW 9 19647288 missense probably damaging 1.00
R6077:Zfp317 UTSW 9 19646888 missense probably benign 0.00
R6573:Zfp317 UTSW 9 19645254 missense probably damaging 0.99
R6652:Zfp317 UTSW 9 19647039 missense probably damaging 1.00
R6750:Zfp317 UTSW 9 19647804 missense probably damaging 1.00
R6875:Zfp317 UTSW 9 19643665 missense probably damaging 0.98
R8054:Zfp317 UTSW 9 19641969 missense probably benign 0.00
Z1177:Zfp317 UTSW 9 19647030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGAAAAGCCTTCAGGAATC -3'
(R):5'- CTGCATAACAACTCAGGTCTTC -3'

Sequencing Primer
(F):5'- TCCACTCTGAAGACACACATGAG -3'
(R):5'- AGGTCTTCTCACACTTTCTACAAAC -3'
Posted On2019-11-12