Incidental Mutation 'R7688:Ets1'
ID593216
Institutional Source Beutler Lab
Gene Symbol Ets1
Ensembl Gene ENSMUSG00000032035
Gene NameE26 avian leukemia oncogene 1, 5' domain
SynonymsTpl1, Ets-1, p51Ets-1, p42Ets-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location32636221-32757820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32696424 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 14 (I14N)
Ref Sequence ENSEMBL: ENSMUSP00000034534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034534] [ENSMUST00000050797] [ENSMUST00000184364] [ENSMUST00000184887]
PDB Structure
Pax5(1-149)+Ets-1(331-440)+DNA [X-RAY DIFFRACTION]
Ets-1(331-440)+GGAA duplex [X-RAY DIFFRACTION]
Ets-1(331-440)+GGAG duplex [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF AN INHIBITED FRAGMENT OF Ets-1 [X-RAY DIFFRACTION]
INHIBITED FRAGMENT OF ETS-1 AND PAIRED DOMAIN OF PAX5 BOUND TO DNA [X-RAY DIFFRACTION]
NMR-based structure of autoinhibited murine Ets-1 deltaN301 [SOLUTION NMR]
Ets-1 PNT domain (29-138) NMR structure ensemble [SOLUTION NMR]
Ras signaling requires dynamic properties of Ets1 for phosphorylation-enhanced binding to co-activator CBP [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034534
AA Change: I14N

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034534
Gene: ENSMUSG00000032035
AA Change: I14N

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
low complexity region 266 278 N/A INTRINSIC
ETS 334 419 1.98e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000050797
AA Change: I14N

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051303
Gene: ENSMUSG00000032035
AA Change: I14N

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
ETS 247 332 1.98e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184364
AA Change: I14N

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139107
Gene: ENSMUSG00000032035
AA Change: I14N

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
ETS 118 203 1.98e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184887
AA Change: I14N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138951
Gene: ENSMUSG00000032035
AA Change: I14N

DomainStartEndE-ValueType
SAM_PNT 53 136 2.56e-48 SMART
Meta Mutation Damage Score 0.3188 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral CD8+ T cells, impaired TCR-mediated activation of both CD4+ and CD8+ T cells, increased numbers of IgM-secreting plasma cells, and severely impaired NK cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Ets1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Ets1 APN 9 32752926 intron probably benign
IGL00899:Ets1 APN 9 32752808 missense probably damaging 1.00
IGL01615:Ets1 APN 9 32732939 splice site probably benign
IGL01867:Ets1 APN 9 32734159 missense probably damaging 0.99
IGL02424:Ets1 APN 9 32754293 nonsense probably null
IGL03204:Ets1 APN 9 32733012 missense possibly damaging 0.64
Ecru UTSW 9 32733960 nonsense probably null
Fawn UTSW 9 32752857 nonsense probably null
R0479:Ets1 UTSW 9 32730180 missense probably damaging 1.00
R0659:Ets1 UTSW 9 32738293 missense probably damaging 1.00
R0839:Ets1 UTSW 9 32734061 nonsense probably null
R5009:Ets1 UTSW 9 32732999 missense possibly damaging 0.85
R5590:Ets1 UTSW 9 32728798 splice site probably benign
R6367:Ets1 UTSW 9 32733960 nonsense probably null
R6423:Ets1 UTSW 9 32738315 missense probably damaging 0.97
R6517:Ets1 UTSW 9 32752797 critical splice acceptor site probably null
R6584:Ets1 UTSW 9 32733997 missense probably damaging 1.00
R7347:Ets1 UTSW 9 32733032 splice site probably null
R7414:Ets1 UTSW 9 32752857 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTTTCGCTTTTGGGAGACG -3'
(R):5'- CGTTTTCCCATTAGTCACAAAACAC -3'

Sequencing Primer
(F):5'- ATTGGCTGCAGATGCTAAGC -3'
(R):5'- TGGCTTCTGCATCCAGTGCTCCT -3'
Posted On2019-11-12