Incidental Mutation 'R7688:Epb41l2'
ID593219
Institutional Source Beutler Lab
Gene Symbol Epb41l2
Ensembl Gene ENSMUSG00000019978
Gene Nameerythrocyte membrane protein band 4.1 like 2
SynonymsNBL2, 4.1G, Epb4.1l2, D10Ertd398e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location25359798-25523519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25479138 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 449 (Y449H)
Ref Sequence ENSEMBL: ENSMUSP00000055122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053748] [ENSMUST00000092645] [ENSMUST00000217929] [ENSMUST00000218903] [ENSMUST00000219805] [ENSMUST00000219900]
Predicted Effect probably damaging
Transcript: ENSMUST00000053748
AA Change: Y449H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055122
Gene: ENSMUSG00000019978
AA Change: Y449H

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 1.8e-23 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 875 981 1.1e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092645
AA Change: Y449H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090314
Gene: ENSMUSG00000019978
AA Change: Y449H

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 6.1e-27 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 869 982 8.2e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217929
AA Change: Y449H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218903
AA Change: Y449H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000219805
AA Change: Y449H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000219900
AA Change: Y449H

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal glutamatergic synapse formation, AMPAR responses and long-term potentiation. Male mice homozygous for a knock-out allele exhibit normal fertility. Male mice homozygous for a gene trap allele on a mixed background are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Epb41l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Epb41l2 APN 10 25501836 missense probably damaging 1.00
IGL00826:Epb41l2 APN 10 25441722 missense probably benign 0.07
IGL01312:Epb41l2 APN 10 25441587 start codon destroyed probably null 1.00
IGL02123:Epb41l2 APN 10 25460844 missense probably damaging 1.00
IGL02448:Epb41l2 APN 10 25493595 missense possibly damaging 0.66
R0365:Epb41l2 UTSW 10 25469221 missense probably damaging 1.00
R0594:Epb41l2 UTSW 10 25443770 missense possibly damaging 0.53
R0826:Epb41l2 UTSW 10 25504192 missense probably damaging 1.00
R0837:Epb41l2 UTSW 10 25507816 missense probably damaging 1.00
R1243:Epb41l2 UTSW 10 25489043 missense possibly damaging 0.81
R1301:Epb41l2 UTSW 10 25443902 missense probably damaging 1.00
R1560:Epb41l2 UTSW 10 25495436 splice site probably null
R1752:Epb41l2 UTSW 10 25460792 missense probably damaging 1.00
R1813:Epb41l2 UTSW 10 25441568 splice site probably null
R1966:Epb41l2 UTSW 10 25441768 missense probably benign 0.01
R2276:Epb41l2 UTSW 10 25488944 unclassified probably benign
R4425:Epb41l2 UTSW 10 25506180 missense possibly damaging 0.81
R4445:Epb41l2 UTSW 10 25443803 missense possibly damaging 0.92
R4621:Epb41l2 UTSW 10 25502140 critical splice donor site probably null
R4720:Epb41l2 UTSW 10 25471626 missense probably damaging 1.00
R5026:Epb41l2 UTSW 10 25484308 missense possibly damaging 0.94
R5408:Epb41l2 UTSW 10 25468094 critical splice acceptor site probably null
R5703:Epb41l2 UTSW 10 25441767 missense probably damaging 1.00
R5896:Epb41l2 UTSW 10 25493596 missense probably damaging 0.96
R5974:Epb41l2 UTSW 10 25441815 missense possibly damaging 0.79
R6073:Epb41l2 UTSW 10 25501832 missense probably damaging 1.00
R6182:Epb41l2 UTSW 10 25507817 missense probably damaging 1.00
R6229:Epb41l2 UTSW 10 25499836 missense possibly damaging 0.73
R6276:Epb41l2 UTSW 10 25502124 missense probably damaging 0.98
R6321:Epb41l2 UTSW 10 25468128 missense probably damaging 0.98
R6737:Epb41l2 UTSW 10 25489018 unclassified probably null
R6766:Epb41l2 UTSW 10 25473092 nonsense probably null
R6834:Epb41l2 UTSW 10 25493604 missense possibly damaging 0.92
R7023:Epb41l2 UTSW 10 25512977 missense probably damaging 1.00
R7258:Epb41l2 UTSW 10 25484287 missense probably damaging 1.00
R7769:Epb41l2 UTSW 10 25493573 missense probably benign
R7796:Epb41l2 UTSW 10 25443829 missense probably benign 0.15
Z1176:Epb41l2 UTSW 10 25441720 missense probably benign 0.03
Z1176:Epb41l2 UTSW 10 25499902 nonsense probably null
Z1177:Epb41l2 UTSW 10 25479741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTGATTTGCCTCAGTCTACC -3'
(R):5'- TCCATCACTTACCTGAGTCAGC -3'

Sequencing Primer
(F):5'- GATTTGCCTCAGTCTACCTAACTTG -3'
(R):5'- CAAAAAGCTCCTACTATGTGTGG -3'
Posted On2019-11-12